\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126339132:

Variant ID: vg1126339132 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26339132
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.09, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TACGGTACACTATACTGCAAGTATAAACAATCTAATGATATAGATTCATCTGATCTTTCCTCTAGATTAGTTTACAATATAAATTGAAAAGGGTAAATTT[A/G]
TCTTTCCATCTTTTTGCGCGTTTCCTTCTTCGGTCAGATCTGGCCCAAGAGAAATCTGCTCAAGAGAATTCCGGTCGCTTTCTTTCATCCCATGCGCTAC

Reverse complement sequence

GTAGCGCATGGGATGAAAGAAAGCGACCGGAATTCTCTTGAGCAGATTTCTCTTGGGCCAGATCTGACCGAAGAAGGAAACGCGCAAAAAGATGGAAAGA[T/C]
AAATTTACCCTTTTCAATTTATATTGTAAACTAATCTAGAGGAAAGATCAGATGAATCTATATCATTAGATTGTTTATACTTGCAGTATAGTGTACCGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.80% 20.50% 0.57% 1.10% NA
All Indica  2759 79.60% 19.60% 0.07% 0.76% NA
All Japonica  1512 75.40% 24.30% 0.33% 0.00% NA
Aus  269 67.30% 14.50% 6.69% 11.52% NA
Indica I  595 96.00% 2.50% 0.00% 1.51% NA
Indica II  465 87.30% 12.70% 0.00% 0.00% NA
Indica III  913 66.90% 32.50% 0.11% 0.44% NA
Indica Intermediate  786 77.20% 21.60% 0.13% 1.02% NA
Temperate Japonica  767 67.50% 32.20% 0.26% 0.00% NA
Tropical Japonica  504 92.30% 7.70% 0.00% 0.00% NA
Japonica Intermediate  241 65.10% 33.60% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126339132 A -> DEL N N silent_mutation Average:35.846; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg1126339132 A -> G LOC_Os11g43650-LOC_Os11g43660 intergenic_region ; MODIFIER silent_mutation Average:35.846; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126339132 NA 9.84E-08 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126339132 NA 2.73E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126339132 3.29E-06 4.45E-08 mr1158_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126339132 NA 8.63E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126339132 NA 8.64E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251