\
| Variant ID: vg1126333420 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26333420 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )
CATATATATACAGAACAAACAAGACAAGCCATGACGTACACATGATGCAACCATCATATCACACTGCACATAAATTCAGTCATTAACTTCACCCCGATTT[A/G]
CATTTTTGTAGGCGGCTATTTGGCTCTAAGGGCTATGTCCGCCTGCGAAAATAAATACCCAACGTTGACGAAAATGCTTTTTCTAGTAGTGCCTCTTGGC
GCCAAGAGGCACTACTAGAAAAAGCATTTTCGTCAACGTTGGGTATTTATTTTCGCAGGCGGACATAGCCCTTAGAGCCAAATAGCCGCCTACAAAAATG[T/C]
AAATCGGGGTGAAGTTAATGACTGAATTTATGTGCAGTGTGATATGATGGTTGCATCATGTGTACGTCATGGCTTGTCTTGTTTGTTCTGTATATATATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 9.30% | 2.43% | 4.74% | NA |
| All Indica | 2759 | 83.50% | 4.80% | 4.02% | 7.72% | NA |
| All Japonica | 1512 | 81.70% | 17.80% | 0.20% | 0.26% | NA |
| Aus | 269 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.90% | 2.20% | 10.25% | 24.71% | NA |
| Indica II | 465 | 81.50% | 2.40% | 6.45% | 9.68% | NA |
| Indica III | 913 | 91.20% | 8.20% | 0.22% | 0.33% | NA |
| Indica Intermediate | 786 | 91.20% | 4.20% | 2.29% | 2.29% | NA |
| Temperate Japonica | 767 | 68.60% | 30.50% | 0.39% | 0.52% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 10.00% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126333420 | A -> DEL | N | N | silent_mutation | Average:50.585; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg1126333420 | A -> G | LOC_Os11g43650.1 | downstream_gene_variant ; 2963.0bp to feature; MODIFIER | silent_mutation | Average:50.585; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg1126333420 | A -> G | LOC_Os11g43650-LOC_Os11g43660 | intergenic_region ; MODIFIER | silent_mutation | Average:50.585; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126333420 | 6.30E-07 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | 1.39E-09 | 2.54E-12 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | 9.45E-07 | 9.10E-09 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | 1.84E-09 | 9.53E-13 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 7.23E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 2.76E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 9.19E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | 3.84E-11 | 6.49E-19 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 7.73E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 3.15E-06 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 1.25E-06 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 4.89E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 2.32E-07 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 9.25E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 1.24E-08 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 9.32E-08 | mr1748_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 4.76E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | NA | 8.94E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126333420 | 2.44E-06 | 2.44E-06 | mr1972_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |