\
| Variant ID: vg1126331556 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26331556 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 222. )
CTTTGGGACGTAGTATTTGAAAAACACAAAAATGGGATAAATGCACGAATATGATGTCATGCATTATTGCATCCCAAAGGAAAAAAGTCCAGAGGCATTT[G/A]
CAAAACATTTTTTTAACCCGATAGGAAAAAACATAGGAATTCTAGAGACAACTAGGGGAAACCATGAGTTAAGACCTAATGTTAGTTTTCCTCCAAAACA
TGTTTTGGAGGAAAACTAACATTAGGTCTTAACTCATGGTTTCCCCTAGTTGTCTCTAGAATTCCTATGTTTTTTCCTATCGGGTTAAAAAAATGTTTTG[C/T]
AAATGCCTCTGGACTTTTTTCCTTTGGGATGCAATAATGCATGACATCATATTCGTGCATTTATCCCATTTTTGTGTTTTTCAAATACTACGTCCCAAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.20% | 19.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 72.10% | 27.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.50% | 46.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 38.50% | 61.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 76.80% | 23.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 85.60% | 14.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126331556 | G -> A | LOC_Os11g43650.1 | downstream_gene_variant ; 1099.0bp to feature; MODIFIER | silent_mutation | Average:29.868; most accessible tissue: Callus, score: 61.627 | N | N | N | N |
| vg1126331556 | G -> A | LOC_Os11g43650-LOC_Os11g43660 | intergenic_region ; MODIFIER | silent_mutation | Average:29.868; most accessible tissue: Callus, score: 61.627 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126331556 | 7.89E-09 | 7.94E-15 | mr1191 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | 9.30E-10 | 7.42E-11 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | 4.79E-09 | 1.23E-15 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | 4.92E-09 | 3.24E-11 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | NA | 4.77E-12 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | NA | 3.27E-10 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | 2.45E-08 | 4.35E-22 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | 5.58E-08 | 2.74E-14 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | 5.23E-06 | 9.47E-10 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | NA | 5.60E-11 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | 5.18E-06 | 1.24E-12 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126331556 | NA | 1.05E-10 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |