\
| Variant ID: vg1126329129 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26329129 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 241. )
AAAAACAAATTAGTTTGAACTATAGTGCATGTTTGTTGATGTGTTGTGCCGTGTTCGGGAAGAATGCCATGCATATTCTCACTACGCTGGACCCTCCCAC[C/T]
ATTGACGGGCCCATGTCATCACCTTTGACGGATTTAGCCCTCGTCAGAGATTAGTGATCACTGATGACTGCACCTCACCTCTGACGGGTGAAAAGCCGTC
GACGGCTTTTCACCCGTCAGAGGTGAGGTGCAGTCATCAGTGATCACTAATCTCTGACGAGGGCTAAATCCGTCAAAGGTGATGACATGGGCCCGTCAAT[G/A]
GTGGGAGGGTCCAGCGTAGTGAGAATATGCATGGCATTCTTCCCGAACACGGCACAACACATCAACAAACATGCACTATAGTTCAAACTAATTTGTTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 41.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 40.40% | 59.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.50% | 77.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 21.50% | 78.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 54.70% | 45.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 48.60% | 51.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126329129 | C -> T | LOC_Os11g43650.1 | upstream_gene_variant ; 559.0bp to feature; MODIFIER | silent_mutation | Average:32.932; most accessible tissue: Zhenshan97 young leaf, score: 55.261 | N | N | N | N |
| vg1126329129 | C -> T | LOC_Os11g43640-LOC_Os11g43650 | intergenic_region ; MODIFIER | silent_mutation | Average:32.932; most accessible tissue: Zhenshan97 young leaf, score: 55.261 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126329129 | NA | 6.76E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126329129 | NA | 2.65E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126329129 | 1.87E-06 | 1.31E-07 | mr1662 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126329129 | NA | 7.99E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126329129 | NA | 6.53E-08 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126329129 | NA | 2.85E-06 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126329129 | NA | 3.22E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126329129 | NA | 2.69E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126329129 | 4.06E-06 | 1.48E-07 | mr1662_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |