Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126329129:

Variant ID: vg1126329129 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26329129
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAACAAATTAGTTTGAACTATAGTGCATGTTTGTTGATGTGTTGTGCCGTGTTCGGGAAGAATGCCATGCATATTCTCACTACGCTGGACCCTCCCAC[C/T]
ATTGACGGGCCCATGTCATCACCTTTGACGGATTTAGCCCTCGTCAGAGATTAGTGATCACTGATGACTGCACCTCACCTCTGACGGGTGAAAAGCCGTC

Reverse complement sequence

GACGGCTTTTCACCCGTCAGAGGTGAGGTGCAGTCATCAGTGATCACTAATCTCTGACGAGGGCTAAATCCGTCAAAGGTGATGACATGGGCCCGTCAAT[G/A]
GTGGGAGGGTCCAGCGTAGTGAGAATATGCATGGCATTCTTCCCGAACACGGCACAACACATCAACAAACATGCACTATAGTTCAAACTAATTTGTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	41.80%	0.06%	0.00%	NA
All Indica	2759	40.40%	59.50%	0.11%	0.00%	NA
All Japonica	1512	93.10%	6.90%	0.00%	0.00%	NA
Aus	269	26.00%	74.00%	0.00%	0.00%	NA
Indica I	595	22.50%	77.50%	0.00%	0.00%	NA
Indica II	465	21.50%	78.50%	0.00%	0.00%	NA
Indica III	913	54.70%	45.30%	0.00%	0.00%	NA
Indica Intermediate	786	48.60%	51.00%	0.38%	0.00%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	87.10%	12.90%	0.00%	0.00%	NA
Japonica Intermediate	241	89.20%	10.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126329129	C -> T	LOC_Os11g43650.1	upstream_gene_variant ; 559.0bp to feature; MODIFIER	silent_mutation	Average:32.932; most accessible tissue: Zhenshan97 young leaf, score: 55.261	N	N	N	N
vg1126329129	C -> T	LOC_Os11g43640-LOC_Os11g43650	intergenic_region ; MODIFIER	silent_mutation	Average:32.932; most accessible tissue: Zhenshan97 young leaf, score: 55.261	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126329129	NA	6.76E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129	NA	2.65E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129	1.87E-06	1.31E-07	mr1662	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129	NA	7.99E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129	NA	6.53E-08	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129	NA	2.85E-06	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129	NA	3.22E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129	NA	2.69E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129	4.06E-06	1.48E-07	mr1662_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251