\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126329129:

Variant ID: vg1126329129 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26329129
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAACAAATTAGTTTGAACTATAGTGCATGTTTGTTGATGTGTTGTGCCGTGTTCGGGAAGAATGCCATGCATATTCTCACTACGCTGGACCCTCCCAC[C/T]
ATTGACGGGCCCATGTCATCACCTTTGACGGATTTAGCCCTCGTCAGAGATTAGTGATCACTGATGACTGCACCTCACCTCTGACGGGTGAAAAGCCGTC

Reverse complement sequence

GACGGCTTTTCACCCGTCAGAGGTGAGGTGCAGTCATCAGTGATCACTAATCTCTGACGAGGGCTAAATCCGTCAAAGGTGATGACATGGGCCCGTCAAT[G/A]
GTGGGAGGGTCCAGCGTAGTGAGAATATGCATGGCATTCTTCCCGAACACGGCACAACACATCAACAAACATGCACTATAGTTCAAACTAATTTGTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.80% 0.06% 0.00% NA
All Indica  2759 40.40% 59.50% 0.11% 0.00% NA
All Japonica  1512 93.10% 6.90% 0.00% 0.00% NA
Aus  269 26.00% 74.00% 0.00% 0.00% NA
Indica I  595 22.50% 77.50% 0.00% 0.00% NA
Indica II  465 21.50% 78.50% 0.00% 0.00% NA
Indica III  913 54.70% 45.30% 0.00% 0.00% NA
Indica Intermediate  786 48.60% 51.00% 0.38% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 87.10% 12.90% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 10.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126329129 C -> T LOC_Os11g43650.1 upstream_gene_variant ; 559.0bp to feature; MODIFIER silent_mutation Average:32.932; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg1126329129 C -> T LOC_Os11g43640-LOC_Os11g43650 intergenic_region ; MODIFIER silent_mutation Average:32.932; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126329129 NA 6.76E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129 NA 2.65E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129 1.87E-06 1.31E-07 mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129 NA 7.99E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129 NA 6.53E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129 NA 2.85E-06 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129 NA 3.22E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129 NA 2.69E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126329129 4.06E-06 1.48E-07 mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251