Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126325661:

Variant ID: vg1126325661 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26325661
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGGGGTTAATCAACTAATCTATACCTAAAAAAATACATAAGGTTTCCGGTATTTTTTTCGTCCGTCACTTTTTTCGCTATTTTTTTCTTCCTTTCGTC[C/T,A]
GTCACTTTTTCCGCTGTTTTTTTTCTTTTTTTCGTCGTTTTTTTTTTCTTTTTTTCTTCTGTCTGCCCTTTTCTTTTTTCTTTTTTTTCCCATCCGCCTT

Reverse complement sequence

AAGGCGGATGGGAAAAAAAAGAAAAAAGAAAAGGGCAGACAGAAGAAAAAAAGAAAAAAAAAACGACGAAAAAAAGAAAAAAAACAGCGGAAAAAGTGAC[G/A,T]
GACGAAAGGAAGAAAAAAATAGCGAAAAAAGTGACGGACGAAAAAAATACCGGAAACCTTATGTATTTTTTTAGGTATAGATTAGTTGATTAACCCCAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.70%	5.60%	1.10%	24.42%	A: 1.23%
All Indica	2759	74.60%	6.50%	0.69%	18.19%	A: 0.04%
All Japonica	1512	55.90%	4.20%	1.72%	34.46%	A: 3.70%
Aus	269	84.80%	4.50%	0.00%	10.78%	NA
Indica I	595	91.90%	1.30%	0.00%	6.72%	NA
Indica II	465	82.60%	4.10%	0.22%	12.90%	A: 0.22%
Indica III	913	66.20%	5.40%	0.99%	27.49%	NA
Indica Intermediate	786	66.50%	13.10%	1.15%	19.21%	NA
Temperate Japonica	767	46.40%	0.30%	2.09%	49.67%	A: 1.56%
Tropical Japonica	504	65.70%	10.70%	1.59%	14.09%	A: 7.94%
Japonica Intermediate	241	65.60%	3.30%	0.83%	28.63%	A: 1.66%
VI/Aromatic	96	10.40%	0.00%	6.25%	83.33%	NA
Intermediate	90	63.30%	10.00%	1.11%	24.44%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126325661	C -> T	LOC_Os11g43640.1	upstream_gene_variant ; 4158.0bp to feature; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Callus, score: 49.889	N	N	N	N
vg1126325661	C -> T	LOC_Os11g43650.1	upstream_gene_variant ; 4027.0bp to feature; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Callus, score: 49.889	N	N	N	N
vg1126325661	C -> T	LOC_Os11g43640-LOC_Os11g43650	intergenic_region ; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Callus, score: 49.889	N	N	N	N
vg1126325661	C -> A	LOC_Os11g43640.1	upstream_gene_variant ; 4158.0bp to feature; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Callus, score: 49.889	N	N	N	N
vg1126325661	C -> A	LOC_Os11g43650.1	upstream_gene_variant ; 4027.0bp to feature; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Callus, score: 49.889	N	N	N	N
vg1126325661	C -> A	LOC_Os11g43640-LOC_Os11g43650	intergenic_region ; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Callus, score: 49.889	N	N	N	N
vg1126325661	C -> DEL	N	N	silent_mutation	Average:19.862; most accessible tissue: Callus, score: 49.889	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126325661	5.79E-07	6.05E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126325661	3.02E-06	NA	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126325661	3.50E-07	1.91E-09	mr1133_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126325661	NA	7.45E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251