\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126325661:

Variant ID: vg1126325661 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26325661
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGGGGTTAATCAACTAATCTATACCTAAAAAAATACATAAGGTTTCCGGTATTTTTTTCGTCCGTCACTTTTTTCGCTATTTTTTTCTTCCTTTCGTC[C/T,A]
GTCACTTTTTCCGCTGTTTTTTTTCTTTTTTTCGTCGTTTTTTTTTTCTTTTTTTCTTCTGTCTGCCCTTTTCTTTTTTCTTTTTTTTCCCATCCGCCTT

Reverse complement sequence

AAGGCGGATGGGAAAAAAAAGAAAAAAGAAAAGGGCAGACAGAAGAAAAAAAGAAAAAAAAAACGACGAAAAAAAGAAAAAAAACAGCGGAAAAAGTGAC[G/A,T]
GACGAAAGGAAGAAAAAAATAGCGAAAAAAGTGACGGACGAAAAAAATACCGGAAACCTTATGTATTTTTTTAGGTATAGATTAGTTGATTAACCCCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 5.60% 1.10% 24.42% A: 1.23%
All Indica  2759 74.60% 6.50% 0.69% 18.19% A: 0.04%
All Japonica  1512 55.90% 4.20% 1.72% 34.46% A: 3.70%
Aus  269 84.80% 4.50% 0.00% 10.78% NA
Indica I  595 91.90% 1.30% 0.00% 6.72% NA
Indica II  465 82.60% 4.10% 0.22% 12.90% A: 0.22%
Indica III  913 66.20% 5.40% 0.99% 27.49% NA
Indica Intermediate  786 66.50% 13.10% 1.15% 19.21% NA
Temperate Japonica  767 46.40% 0.30% 2.09% 49.67% A: 1.56%
Tropical Japonica  504 65.70% 10.70% 1.59% 14.09% A: 7.94%
Japonica Intermediate  241 65.60% 3.30% 0.83% 28.63% A: 1.66%
VI/Aromatic  96 10.40% 0.00% 6.25% 83.33% NA
Intermediate  90 63.30% 10.00% 1.11% 24.44% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126325661 C -> T LOC_Os11g43640.1 upstream_gene_variant ; 4158.0bp to feature; MODIFIER silent_mutation Average:19.862; most accessible tissue: Callus, score: 49.889 N N N N
vg1126325661 C -> T LOC_Os11g43650.1 upstream_gene_variant ; 4027.0bp to feature; MODIFIER silent_mutation Average:19.862; most accessible tissue: Callus, score: 49.889 N N N N
vg1126325661 C -> T LOC_Os11g43640-LOC_Os11g43650 intergenic_region ; MODIFIER silent_mutation Average:19.862; most accessible tissue: Callus, score: 49.889 N N N N
vg1126325661 C -> A LOC_Os11g43640.1 upstream_gene_variant ; 4158.0bp to feature; MODIFIER silent_mutation Average:19.862; most accessible tissue: Callus, score: 49.889 N N N N
vg1126325661 C -> A LOC_Os11g43650.1 upstream_gene_variant ; 4027.0bp to feature; MODIFIER silent_mutation Average:19.862; most accessible tissue: Callus, score: 49.889 N N N N
vg1126325661 C -> A LOC_Os11g43640-LOC_Os11g43650 intergenic_region ; MODIFIER silent_mutation Average:19.862; most accessible tissue: Callus, score: 49.889 N N N N
vg1126325661 C -> DEL N N silent_mutation Average:19.862; most accessible tissue: Callus, score: 49.889 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126325661 5.79E-07 6.05E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126325661 3.02E-06 NA mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126325661 3.50E-07 1.91E-09 mr1133_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126325661 NA 7.45E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251