\
| Variant ID: vg1126325661 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26325661 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )
ATTGGGGTTAATCAACTAATCTATACCTAAAAAAATACATAAGGTTTCCGGTATTTTTTTCGTCCGTCACTTTTTTCGCTATTTTTTTCTTCCTTTCGTC[C/T,A]
GTCACTTTTTCCGCTGTTTTTTTTCTTTTTTTCGTCGTTTTTTTTTTCTTTTTTTCTTCTGTCTGCCCTTTTCTTTTTTCTTTTTTTTCCCATCCGCCTT
AAGGCGGATGGGAAAAAAAAGAAAAAAGAAAAGGGCAGACAGAAGAAAAAAAGAAAAAAAAAACGACGAAAAAAAGAAAAAAAACAGCGGAAAAAGTGAC[G/A,T]
GACGAAAGGAAGAAAAAAATAGCGAAAAAAGTGACGGACGAAAAAAATACCGGAAACCTTATGTATTTTTTTAGGTATAGATTAGTTGATTAACCCCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.70% | 5.60% | 1.10% | 24.42% | A: 1.23% |
| All Indica | 2759 | 74.60% | 6.50% | 0.69% | 18.19% | A: 0.04% |
| All Japonica | 1512 | 55.90% | 4.20% | 1.72% | 34.46% | A: 3.70% |
| Aus | 269 | 84.80% | 4.50% | 0.00% | 10.78% | NA |
| Indica I | 595 | 91.90% | 1.30% | 0.00% | 6.72% | NA |
| Indica II | 465 | 82.60% | 4.10% | 0.22% | 12.90% | A: 0.22% |
| Indica III | 913 | 66.20% | 5.40% | 0.99% | 27.49% | NA |
| Indica Intermediate | 786 | 66.50% | 13.10% | 1.15% | 19.21% | NA |
| Temperate Japonica | 767 | 46.40% | 0.30% | 2.09% | 49.67% | A: 1.56% |
| Tropical Japonica | 504 | 65.70% | 10.70% | 1.59% | 14.09% | A: 7.94% |
| Japonica Intermediate | 241 | 65.60% | 3.30% | 0.83% | 28.63% | A: 1.66% |
| VI/Aromatic | 96 | 10.40% | 0.00% | 6.25% | 83.33% | NA |
| Intermediate | 90 | 63.30% | 10.00% | 1.11% | 24.44% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126325661 | C -> T | LOC_Os11g43640.1 | upstream_gene_variant ; 4158.0bp to feature; MODIFIER | silent_mutation | Average:19.862; most accessible tissue: Callus, score: 49.889 | N | N | N | N |
| vg1126325661 | C -> T | LOC_Os11g43650.1 | upstream_gene_variant ; 4027.0bp to feature; MODIFIER | silent_mutation | Average:19.862; most accessible tissue: Callus, score: 49.889 | N | N | N | N |
| vg1126325661 | C -> T | LOC_Os11g43640-LOC_Os11g43650 | intergenic_region ; MODIFIER | silent_mutation | Average:19.862; most accessible tissue: Callus, score: 49.889 | N | N | N | N |
| vg1126325661 | C -> A | LOC_Os11g43640.1 | upstream_gene_variant ; 4158.0bp to feature; MODIFIER | silent_mutation | Average:19.862; most accessible tissue: Callus, score: 49.889 | N | N | N | N |
| vg1126325661 | C -> A | LOC_Os11g43650.1 | upstream_gene_variant ; 4027.0bp to feature; MODIFIER | silent_mutation | Average:19.862; most accessible tissue: Callus, score: 49.889 | N | N | N | N |
| vg1126325661 | C -> A | LOC_Os11g43640-LOC_Os11g43650 | intergenic_region ; MODIFIER | silent_mutation | Average:19.862; most accessible tissue: Callus, score: 49.889 | N | N | N | N |
| vg1126325661 | C -> DEL | N | N | silent_mutation | Average:19.862; most accessible tissue: Callus, score: 49.889 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126325661 | 5.79E-07 | 6.05E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126325661 | 3.02E-06 | NA | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126325661 | 3.50E-07 | 1.91E-09 | mr1133_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126325661 | NA | 7.45E-08 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |