\
| Variant ID: vg1126298122 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26298122 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 88. )
CACGAATTTGCTATTACTTTAAAGAGAAACTTTTAGCAATTTCTGTGTAAATAATCTGATAAAATTTCCTTGTAACCACTATAAATTTGCTACTTCCTCC[G/A]
TTTCATAATGTAAGTCATTTTAGCATTTTCCACATTCATATTGATGTTAATGAATCTAGATAATATATATGTCTAGATGCATTAACATCATATAAATGTA
TACATTTATATGATGTTAATGCATCTAGACATATATATTATCTAGATTCATTAACATCAATATGAATGTGGAAAATGCTAAAATGACTTACATTATGAAA[C/T]
GGAGGAAGTAGCAAATTTATAGTGGTTACAAGGAAATTTTATCAGATTATTTACACAGAAATTGCTAAAAGTTTCTCTTTAAAGTAATAGCAAATTCGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.40% | 23.60% | 6.62% | 1.35% | NA |
| All Indica | 2759 | 59.10% | 29.90% | 8.77% | 2.28% | NA |
| All Japonica | 1512 | 91.30% | 7.10% | 1.52% | 0.00% | NA |
| Aus | 269 | 50.90% | 39.00% | 10.04% | 0.00% | NA |
| Indica I | 595 | 36.60% | 54.60% | 8.07% | 0.67% | NA |
| Indica II | 465 | 26.00% | 42.60% | 23.23% | 8.17% | NA |
| Indica III | 913 | 85.90% | 11.50% | 2.52% | 0.11% | NA |
| Indica Intermediate | 786 | 64.50% | 24.90% | 8.02% | 2.54% | NA |
| Temperate Japonica | 767 | 94.30% | 4.60% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 92.10% | 6.70% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.50% | 16.20% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 64.60% | 17.71% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 20.00% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126298122 | G -> A | LOC_Os11g43590.1 | upstream_gene_variant ; 1735.0bp to feature; MODIFIER | silent_mutation | Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg1126298122 | G -> A | LOC_Os11g43590.2 | upstream_gene_variant ; 1638.0bp to feature; MODIFIER | silent_mutation | Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg1126298122 | G -> A | LOC_Os11g43590.3 | upstream_gene_variant ; 1735.0bp to feature; MODIFIER | silent_mutation | Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg1126298122 | G -> A | LOC_Os11g43590.4 | upstream_gene_variant ; 1735.0bp to feature; MODIFIER | silent_mutation | Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg1126298122 | G -> A | LOC_Os11g43570.1 | downstream_gene_variant ; 4924.0bp to feature; MODIFIER | silent_mutation | Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg1126298122 | G -> A | LOC_Os11g43580.1 | downstream_gene_variant ; 3610.0bp to feature; MODIFIER | silent_mutation | Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg1126298122 | G -> A | LOC_Os11g43580-LOC_Os11g43590 | intergenic_region ; MODIFIER | silent_mutation | Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg1126298122 | G -> DEL | N | N | silent_mutation | Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126298122 | NA | 1.95E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126298122 | 5.93E-07 | 2.47E-17 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126298122 | NA | 5.71E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126298122 | NA | 1.16E-09 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126298122 | NA | 4.07E-07 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126298122 | 6.77E-07 | NA | mr1133_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126298122 | 2.23E-07 | 2.99E-17 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126298122 | 2.23E-06 | NA | mr1667_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126298122 | 1.19E-08 | 3.27E-14 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |