\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126298122:

Variant ID: vg1126298122 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26298122
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CACGAATTTGCTATTACTTTAAAGAGAAACTTTTAGCAATTTCTGTGTAAATAATCTGATAAAATTTCCTTGTAACCACTATAAATTTGCTACTTCCTCC[G/A]
TTTCATAATGTAAGTCATTTTAGCATTTTCCACATTCATATTGATGTTAATGAATCTAGATAATATATATGTCTAGATGCATTAACATCATATAAATGTA

Reverse complement sequence

TACATTTATATGATGTTAATGCATCTAGACATATATATTATCTAGATTCATTAACATCAATATGAATGTGGAAAATGCTAAAATGACTTACATTATGAAA[C/T]
GGAGGAAGTAGCAAATTTATAGTGGTTACAAGGAAATTTTATCAGATTATTTACACAGAAATTGCTAAAAGTTTCTCTTTAAAGTAATAGCAAATTCGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 23.60% 6.62% 1.35% NA
All Indica  2759 59.10% 29.90% 8.77% 2.28% NA
All Japonica  1512 91.30% 7.10% 1.52% 0.00% NA
Aus  269 50.90% 39.00% 10.04% 0.00% NA
Indica I  595 36.60% 54.60% 8.07% 0.67% NA
Indica II  465 26.00% 42.60% 23.23% 8.17% NA
Indica III  913 85.90% 11.50% 2.52% 0.11% NA
Indica Intermediate  786 64.50% 24.90% 8.02% 2.54% NA
Temperate Japonica  767 94.30% 4.60% 1.17% 0.00% NA
Tropical Japonica  504 92.10% 6.70% 1.19% 0.00% NA
Japonica Intermediate  241 80.50% 16.20% 3.32% 0.00% NA
VI/Aromatic  96 17.70% 64.60% 17.71% 0.00% NA
Intermediate  90 74.40% 20.00% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126298122 G -> A LOC_Os11g43590.1 upstream_gene_variant ; 1735.0bp to feature; MODIFIER silent_mutation Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg1126298122 G -> A LOC_Os11g43590.2 upstream_gene_variant ; 1638.0bp to feature; MODIFIER silent_mutation Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg1126298122 G -> A LOC_Os11g43590.3 upstream_gene_variant ; 1735.0bp to feature; MODIFIER silent_mutation Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg1126298122 G -> A LOC_Os11g43590.4 upstream_gene_variant ; 1735.0bp to feature; MODIFIER silent_mutation Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg1126298122 G -> A LOC_Os11g43570.1 downstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg1126298122 G -> A LOC_Os11g43580.1 downstream_gene_variant ; 3610.0bp to feature; MODIFIER silent_mutation Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg1126298122 G -> A LOC_Os11g43580-LOC_Os11g43590 intergenic_region ; MODIFIER silent_mutation Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg1126298122 G -> DEL N N silent_mutation Average:44.164; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126298122 NA 1.95E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126298122 5.93E-07 2.47E-17 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126298122 NA 5.71E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126298122 NA 1.16E-09 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126298122 NA 4.07E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126298122 6.77E-07 NA mr1133_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126298122 2.23E-07 2.99E-17 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126298122 2.23E-06 NA mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126298122 1.19E-08 3.27E-14 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251