\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126275743:

Variant ID: vg1126275743 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26275743
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCCGCGCAATCTGCGCGGGCCTCCATGCTAGTTCCCTATAAAAAGGGAAGCAAACCATGCAAACTTCTTCACAACACAAATCAGCAACGAGCTCACAA[C/A]
CCAAGCCAGACAGGAGAAGCTTCTAGAACCTTCCAGAAGCAAGGTAGCTAATCGATCGATCGATCAATGGCGGAGATGGTGGCGAGGCTGGCGTCGGAGA

Reverse complement sequence

TCTCCGACGCCAGCCTCGCCACCATCTCCGCCATTGATCGATCGATCGATTAGCTACCTTGCTTCTGGAAGGTTCTAGAAGCTTCTCCTGTCTGGCTTGG[G/T]
TTGTGAGCTCGTTGCTGATTTGTGTTGTGAAGAAGTTTGCATGGTTTGCTTCCCTTTTTATAGGGAACTAGCATGGAGGCCCGCGCAGATTGCGCGGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 44.60% 0.04% 0.00% NA
All Indica  2759 44.50% 55.40% 0.04% 0.00% NA
All Japonica  1512 74.90% 25.00% 0.07% 0.00% NA
Aus  269 40.50% 59.50% 0.00% 0.00% NA
Indica I  595 36.00% 63.90% 0.17% 0.00% NA
Indica II  465 66.70% 33.30% 0.00% 0.00% NA
Indica III  913 27.60% 72.40% 0.00% 0.00% NA
Indica Intermediate  786 57.60% 42.40% 0.00% 0.00% NA
Temperate Japonica  767 93.00% 7.00% 0.00% 0.00% NA
Tropical Japonica  504 42.30% 57.50% 0.20% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126275743 C -> A LOC_Os11g43530.1 upstream_gene_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:40.028; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1126275743 C -> A LOC_Os11g43540.1 upstream_gene_variant ; 3635.0bp to feature; MODIFIER silent_mutation Average:40.028; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1126275743 C -> A LOC_Os11g43520-LOC_Os11g43530 intergenic_region ; MODIFIER silent_mutation Average:40.028; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126275743 4.62E-06 4.62E-06 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 7.25E-07 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 9.30E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 4.42E-09 mr1090 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 2.71E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 6.69E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 2.04E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 1.90E-08 1.95E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 3.88E-06 1.26E-08 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 1.03E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 3.06E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 1.08E-07 2.37E-14 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 8.61E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 2.53E-06 7.50E-14 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743 NA 1.83E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251