Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126275743:

Variant ID: vg1126275743 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26275743
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCCGCGCAATCTGCGCGGGCCTCCATGCTAGTTCCCTATAAAAAGGGAAGCAAACCATGCAAACTTCTTCACAACACAAATCAGCAACGAGCTCACAA[C/A]
CCAAGCCAGACAGGAGAAGCTTCTAGAACCTTCCAGAAGCAAGGTAGCTAATCGATCGATCGATCAATGGCGGAGATGGTGGCGAGGCTGGCGTCGGAGA

Reverse complement sequence

TCTCCGACGCCAGCCTCGCCACCATCTCCGCCATTGATCGATCGATCGATTAGCTACCTTGCTTCTGGAAGGTTCTAGAAGCTTCTCCTGTCTGGCTTGG[G/T]
TTGTGAGCTCGTTGCTGATTTGTGTTGTGAAGAAGTTTGCATGGTTTGCTTCCCTTTTTATAGGGAACTAGCATGGAGGCCCGCGCAGATTGCGCGGCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	44.60%	0.04%	0.00%	NA
All Indica	2759	44.50%	55.40%	0.04%	0.00%	NA
All Japonica	1512	74.90%	25.00%	0.07%	0.00%	NA
Aus	269	40.50%	59.50%	0.00%	0.00%	NA
Indica I	595	36.00%	63.90%	0.17%	0.00%	NA
Indica II	465	66.70%	33.30%	0.00%	0.00%	NA
Indica III	913	27.60%	72.40%	0.00%	0.00%	NA
Indica Intermediate	786	57.60%	42.40%	0.00%	0.00%	NA
Temperate Japonica	767	93.00%	7.00%	0.00%	0.00%	NA
Tropical Japonica	504	42.30%	57.50%	0.20%	0.00%	NA
Japonica Intermediate	241	85.90%	14.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	55.60%	44.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126275743	C -> A	LOC_Os11g43530.1	upstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:40.028; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg1126275743	C -> A	LOC_Os11g43540.1	upstream_gene_variant ; 3635.0bp to feature; MODIFIER	silent_mutation	Average:40.028; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg1126275743	C -> A	LOC_Os11g43520-LOC_Os11g43530	intergenic_region ; MODIFIER	silent_mutation	Average:40.028; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126275743	4.62E-06	4.62E-06	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	7.25E-07	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	9.30E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	4.42E-09	mr1090	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	2.71E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	6.69E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	2.04E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	1.90E-08	1.95E-12	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	3.88E-06	1.26E-08	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	1.03E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	3.06E-12	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	1.08E-07	2.37E-14	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	8.61E-14	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	2.53E-06	7.50E-14	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126275743	NA	1.83E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251