\
| Variant ID: vg1126274190 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26274190 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )
CGACTCACGACATAAAACGACACTGTAAACATGTTAGTGATCATCAAATGTTTAAACTTCACAGACATTGCAGGAAATTCAGTCAAAGACTGCCTGTTTC[G/T]
TCGGAGGCGTTGCGATGATTGGTTACGGTTATCTTCAGTCTCCACGCAGCCATTGGTATGGGGGAGATTTGTTTCACAAGTCAAATCAGGATGAGGTGCA
TGCACCTCATCCTGATTTGACTTGTGAAACAAATCTCCCCCATACCAATGGCTGCGTGGAGACTGAAGATAACCGTAACCAATCATCGCAACGCCTCCGA[C/A]
GAAACAGGCAGTCTTTGACTGAATTTCCTGCAATGTCTGTGAAGTTTAAACATTTGATGATCACTAACATGTTTACAGTGTCGTTTTATGTCGTGAGTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 44.60% | 0.17% | 0.08% | NA |
| All Indica | 2759 | 44.30% | 55.40% | 0.22% | 0.11% | NA |
| All Japonica | 1512 | 75.00% | 24.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 40.10% | 59.50% | 0.00% | 0.37% | NA |
| Indica I | 595 | 35.60% | 64.00% | 0.17% | 0.17% | NA |
| Indica II | 465 | 66.70% | 33.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 27.30% | 72.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 57.40% | 42.20% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 42.50% | 57.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 44.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126274190 | G -> T | LOC_Os11g43530.1 | upstream_gene_variant ; 1620.0bp to feature; MODIFIER | silent_mutation | Average:50.654; most accessible tissue: Callus, score: 83.874 | N | N | N | N |
| vg1126274190 | G -> T | LOC_Os11g43520.1 | downstream_gene_variant ; 3602.0bp to feature; MODIFIER | silent_mutation | Average:50.654; most accessible tissue: Callus, score: 83.874 | N | N | N | N |
| vg1126274190 | G -> T | LOC_Os11g43520-LOC_Os11g43530 | intergenic_region ; MODIFIER | silent_mutation | Average:50.654; most accessible tissue: Callus, score: 83.874 | N | N | N | N |
| vg1126274190 | G -> DEL | N | N | silent_mutation | Average:50.654; most accessible tissue: Callus, score: 83.874 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126274190 | NA | 1.98E-06 | mr1078 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | NA | 4.57E-09 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | NA | 2.01E-07 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | NA | 4.48E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | 3.51E-08 | 3.11E-12 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | 3.22E-06 | 9.40E-09 | mr1211 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | NA | 9.27E-07 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | NA | 1.56E-12 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | 3.11E-08 | 1.21E-14 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | NA | 1.26E-12 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126274190 | NA | 3.91E-06 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |