\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126274190:

Variant ID: vg1126274190 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26274190
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CGACTCACGACATAAAACGACACTGTAAACATGTTAGTGATCATCAAATGTTTAAACTTCACAGACATTGCAGGAAATTCAGTCAAAGACTGCCTGTTTC[G/T]
TCGGAGGCGTTGCGATGATTGGTTACGGTTATCTTCAGTCTCCACGCAGCCATTGGTATGGGGGAGATTTGTTTCACAAGTCAAATCAGGATGAGGTGCA

Reverse complement sequence

TGCACCTCATCCTGATTTGACTTGTGAAACAAATCTCCCCCATACCAATGGCTGCGTGGAGACTGAAGATAACCGTAACCAATCATCGCAACGCCTCCGA[C/A]
GAAACAGGCAGTCTTTGACTGAATTTCCTGCAATGTCTGTGAAGTTTAAACATTTGATGATCACTAACATGTTTACAGTGTCGTTTTATGTCGTGAGTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 44.60% 0.17% 0.08% NA
All Indica  2759 44.30% 55.40% 0.22% 0.11% NA
All Japonica  1512 75.00% 24.90% 0.07% 0.00% NA
Aus  269 40.10% 59.50% 0.00% 0.37% NA
Indica I  595 35.60% 64.00% 0.17% 0.17% NA
Indica II  465 66.70% 33.10% 0.22% 0.00% NA
Indica III  913 27.30% 72.40% 0.33% 0.00% NA
Indica Intermediate  786 57.40% 42.20% 0.13% 0.25% NA
Temperate Japonica  767 93.00% 7.00% 0.00% 0.00% NA
Tropical Japonica  504 42.50% 57.30% 0.20% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126274190 G -> T LOC_Os11g43530.1 upstream_gene_variant ; 1620.0bp to feature; MODIFIER silent_mutation Average:50.654; most accessible tissue: Callus, score: 83.874 N N N N
vg1126274190 G -> T LOC_Os11g43520.1 downstream_gene_variant ; 3602.0bp to feature; MODIFIER silent_mutation Average:50.654; most accessible tissue: Callus, score: 83.874 N N N N
vg1126274190 G -> T LOC_Os11g43520-LOC_Os11g43530 intergenic_region ; MODIFIER silent_mutation Average:50.654; most accessible tissue: Callus, score: 83.874 N N N N
vg1126274190 G -> DEL N N silent_mutation Average:50.654; most accessible tissue: Callus, score: 83.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126274190 NA 1.98E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 NA 4.57E-09 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 NA 2.01E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 NA 4.48E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 3.51E-08 3.11E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 3.22E-06 9.40E-09 mr1211 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 NA 9.27E-07 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 NA 1.56E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 3.11E-08 1.21E-14 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 NA 1.26E-12 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190 NA 3.91E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251