Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1126274190:

Variant ID: vg1126274190 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26274190
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

CGACTCACGACATAAAACGACACTGTAAACATGTTAGTGATCATCAAATGTTTAAACTTCACAGACATTGCAGGAAATTCAGTCAAAGACTGCCTGTTTC[G/T]
TCGGAGGCGTTGCGATGATTGGTTACGGTTATCTTCAGTCTCCACGCAGCCATTGGTATGGGGGAGATTTGTTTCACAAGTCAAATCAGGATGAGGTGCA

Reverse complement sequence

TGCACCTCATCCTGATTTGACTTGTGAAACAAATCTCCCCCATACCAATGGCTGCGTGGAGACTGAAGATAACCGTAACCAATCATCGCAACGCCTCCGA[C/A]
GAAACAGGCAGTCTTTGACTGAATTTCCTGCAATGTCTGTGAAGTTTAAACATTTGATGATCACTAACATGTTTACAGTGTCGTTTTATGTCGTGAGTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	44.60%	0.17%	0.08%	NA
All Indica	2759	44.30%	55.40%	0.22%	0.11%	NA
All Japonica	1512	75.00%	24.90%	0.07%	0.00%	NA
Aus	269	40.10%	59.50%	0.00%	0.37%	NA
Indica I	595	35.60%	64.00%	0.17%	0.17%	NA
Indica II	465	66.70%	33.10%	0.22%	0.00%	NA
Indica III	913	27.30%	72.40%	0.33%	0.00%	NA
Indica Intermediate	786	57.40%	42.20%	0.13%	0.25%	NA
Temperate Japonica	767	93.00%	7.00%	0.00%	0.00%	NA
Tropical Japonica	504	42.50%	57.30%	0.20%	0.00%	NA
Japonica Intermediate	241	85.90%	14.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	54.40%	44.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126274190	G -> T	LOC_Os11g43530.1	upstream_gene_variant ; 1620.0bp to feature; MODIFIER	silent_mutation	Average:50.654; most accessible tissue: Callus, score: 83.874	N	N	N	N
vg1126274190	G -> T	LOC_Os11g43520.1	downstream_gene_variant ; 3602.0bp to feature; MODIFIER	silent_mutation	Average:50.654; most accessible tissue: Callus, score: 83.874	N	N	N	N
vg1126274190	G -> T	LOC_Os11g43520-LOC_Os11g43530	intergenic_region ; MODIFIER	silent_mutation	Average:50.654; most accessible tissue: Callus, score: 83.874	N	N	N	N
vg1126274190	G -> DEL	N	N	silent_mutation	Average:50.654; most accessible tissue: Callus, score: 83.874	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126274190	NA	1.98E-06	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	NA	4.57E-09	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	NA	2.01E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	NA	4.48E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	3.51E-08	3.11E-12	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	3.22E-06	9.40E-09	mr1211	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	NA	9.27E-07	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	NA	1.56E-12	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	3.11E-08	1.21E-14	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	NA	1.26E-12	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126274190	NA	3.91E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251