Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126217994:

Variant ID: vg1126217994 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26217994
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


ACGTCCTCTCCGACCAAGTGCAGCTGCTAGGCGGGCTGAGGCGCGAGGTGCAGTTCATCCGGGACGAGATGGAGAGCATGAACGGCTTCCTCCTCAATCA[T/C]
GCCCGCAGGGGCCGCATGGACCACCAGCTCCAGGCGTGGATGAACCAGGTCAAGGACCTCGCCAACCATTCCCAGTACTGCGTCGACCAGTACTTGCGGT

Reverse complement sequence

ACCGCAAGTACTGGTCGACGCAGTACTGGGAATGGTTGGCGAGGTCCTTGACCTGGTTCATCCACGCCTGGAGCTGGTGGTCCATGCGGCCCCTGCGGGC[A/G]
TGATTGAGGAGGAAGCCGTTCATGCTCTCCATCTCGTCCCGGATGAACTGCACCTCGCGCCTCAGCCCGCCTAGCAGCTGCACTTGGTCGGAGAGGACGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 41.10% 0.40% 2.16% NA
All Indica  2759 39.90% 60.10% 0.04% 0.04% NA
All Japonica  1512 86.00% 6.50% 1.06% 6.35% NA
Aus  269 42.40% 56.10% 0.00% 1.49% NA
Indica I  595 23.70% 76.30% 0.00% 0.00% NA
Indica II  465 67.70% 32.30% 0.00% 0.00% NA
Indica III  913 30.70% 69.20% 0.11% 0.00% NA
Indica Intermediate  786 46.30% 53.60% 0.00% 0.13% NA
Temperate Japonica  767 96.10% 3.30% 0.13% 0.52% NA
Tropical Japonica  504 76.20% 11.90% 2.18% 9.72% NA
Japonica Intermediate  241 74.70% 5.80% 1.66% 17.84% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126217994 T -> DEL LOC_Os11g43420.1 N frameshift_variant Average:82.338; most accessible tissue: Zhenshan97 root, score: 92.495 N N N N
vg1126217994 T -> C LOC_Os11g43420.1 synonymous_variant ; p.His55His; LOW synonymous_codon Average:82.338; most accessible tissue: Zhenshan97 root, score: 92.495 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126217994 T C 0.01 -0.01 -0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126217994 2.10E-06 2.59E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126217994 9.06E-06 3.07E-08 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126217994 4.07E-07 4.07E-07 mr1644 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126217994 NA 1.66E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126217994 NA 5.56E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251