Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126208526:

Variant ID: vg1126208526 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26208526
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGAGATTGGTCTGGTGTTTCTGCGACATGGAGAAGATTGGGCAATCACATGCATTTCCACAAAATATAGGGTGTAAACGGTATAGGAATCTTTCCGAC[A/G]
GTATTGATATCACTTCCACAAAACTAATATAACAATAACTAATATATCTTTGCTTCTTAAATTCCAGATTTCCACTCTAATTAACAAAAATAAAACTACA

Reverse complement sequence

TGTAGTTTTATTTTTGTTAATTAGAGTGGAAATCTGGAATTTAAGAAGCAAAGATATATTAGTTATTGTTATATTAGTTTTGTGGAAGTGATATCAATAC[T/C]
GTCGGAAAGATTCCTATACCGTTTACACCCTATATTTTGTGGAAATGCATGTGATTGCCCAATCTTCTCCATGTCGCAGAAACACCAGACCAATCTCTCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	15.10%	1.69%	33.16%	NA
All Indica	2759	31.60%	21.20%	2.43%	44.69%	NA
All Japonica	1512	85.60%	3.10%	0.40%	10.91%	NA
Aus	269	24.20%	27.10%	1.49%	47.21%	NA
Indica I	595	23.20%	3.20%	1.85%	71.76%	NA
Indica II	465	48.60%	23.00%	2.37%	26.02%	NA
Indica III	913	23.80%	26.20%	2.63%	47.43%	NA
Indica Intermediate	786	37.20%	28.10%	2.67%	32.06%	NA
Temperate Japonica	767	96.90%	0.80%	0.13%	2.22%	NA
Tropical Japonica	504	74.40%	7.30%	0.99%	17.26%	NA
Japonica Intermediate	241	73.00%	1.70%	0.00%	25.31%	NA
VI/Aromatic	96	87.50%	1.00%	0.00%	11.46%	NA
Intermediate	90	53.30%	8.90%	3.33%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126208526	A -> DEL	N	N	silent_mutation	Average:51.841; most accessible tissue: Minghui63 flower, score: 77.232	N	N	N	N
vg1126208526	A -> G	LOC_Os11g43410.1	upstream_gene_variant ; 4510.0bp to feature; MODIFIER	silent_mutation	Average:51.841; most accessible tissue: Minghui63 flower, score: 77.232	N	N	N	N
vg1126208526	A -> G	LOC_Os11g43404.1	downstream_gene_variant ; 2536.0bp to feature; MODIFIER	silent_mutation	Average:51.841; most accessible tissue: Minghui63 flower, score: 77.232	N	N	N	N
vg1126208526	A -> G	LOC_Os11g43404.3	downstream_gene_variant ; 2536.0bp to feature; MODIFIER	silent_mutation	Average:51.841; most accessible tissue: Minghui63 flower, score: 77.232	N	N	N	N
vg1126208526	A -> G	LOC_Os11g43404.2	downstream_gene_variant ; 2535.0bp to feature; MODIFIER	silent_mutation	Average:51.841; most accessible tissue: Minghui63 flower, score: 77.232	N	N	N	N
vg1126208526	A -> G	LOC_Os11g43404.5	downstream_gene_variant ; 2535.0bp to feature; MODIFIER	silent_mutation	Average:51.841; most accessible tissue: Minghui63 flower, score: 77.232	N	N	N	N
vg1126208526	A -> G	LOC_Os11g43404.6	downstream_gene_variant ; 2535.0bp to feature; MODIFIER	silent_mutation	Average:51.841; most accessible tissue: Minghui63 flower, score: 77.232	N	N	N	N
vg1126208526	A -> G	LOC_Os11g43404.4	downstream_gene_variant ; 2512.0bp to feature; MODIFIER	silent_mutation	Average:51.841; most accessible tissue: Minghui63 flower, score: 77.232	N	N	N	N
vg1126208526	A -> G	LOC_Os11g43404-LOC_Os11g43410	intergenic_region ; MODIFIER	silent_mutation	Average:51.841; most accessible tissue: Minghui63 flower, score: 77.232	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126208526	1.81E-06	1.81E-06	mr1540	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126208526	1.90E-06	1.94E-07	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126208526	NA	9.34E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251