\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126193023:

Variant ID: vg1126193023 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 26193023
Reference Allele: GAlternative Allele: A,GTATATT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGACAAGTTTGCCCTTTTTAAGTTTATACTGCAGTATCATTACGTAGGGAGATAAATCAATCTACACTGTTAGATTGTTTATACTACAAGTATATACT[G/A,GTATATT]
GTAGTATATTGTACCGTAAAAGTTCTCTATGATCTCCCGAGGTAGAGTCCATTGATCAGCAAGGCTAGCTAGCAGCTAGTATATGGGTAGCGTGCAAGCT

Reverse complement sequence

AGCTTGCACGCTACCCATATACTAGCTGCTAGCTAGCCTTGCTGATCAATGGACTCTACCTCGGGAGATCATAGAGAACTTTTACGGTACAATATACTAC[C/T,AATATAC]
AGTATATACTTGTAGTATAAACAATCTAACAGTGTAGATTGATTTATCTCCCTACGTAATGATACTGCAGTATAAACTTAAAAAGGGCAAACTTGTCTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 10.30% 3.17% 32.67% GTATATT: 0.11%
All Indica  2759 38.30% 14.90% 4.20% 42.37% GTATATT: 0.18%
All Japonica  1512 83.70% 3.20% 1.59% 11.51% NA
Aus  269 43.50% 9.30% 2.60% 44.61% NA
Indica I  595 23.70% 21.00% 3.70% 51.60% NA
Indica II  465 66.00% 2.60% 3.66% 27.74% NA
Indica III  913 29.70% 20.80% 3.94% 45.02% GTATATT: 0.55%
Indica Intermediate  786 43.10% 10.70% 5.22% 40.97% NA
Temperate Japonica  767 96.20% 0.40% 0.26% 3.13% NA
Tropical Japonica  504 72.80% 1.60% 1.79% 23.81% NA
Japonica Intermediate  241 66.80% 15.40% 5.39% 12.45% NA
VI/Aromatic  96 52.10% 0.00% 0.00% 47.92% NA
Intermediate  90 52.20% 5.60% 3.33% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126193023 G -> GTATATT LOC_Os11g43380.1 upstream_gene_variant ; 2240.0bp to feature; MODIFIER silent_mutation Average:69.532; most accessible tissue: Callus, score: 90.775 N N N N
vg1126193023 G -> GTATATT LOC_Os11g43390.1 downstream_gene_variant ; 2106.0bp to feature; MODIFIER silent_mutation Average:69.532; most accessible tissue: Callus, score: 90.775 N N N N
vg1126193023 G -> GTATATT LOC_Os11g43380-LOC_Os11g43390 intergenic_region ; MODIFIER silent_mutation Average:69.532; most accessible tissue: Callus, score: 90.775 N N N N
vg1126193023 G -> A LOC_Os11g43380.1 upstream_gene_variant ; 2239.0bp to feature; MODIFIER silent_mutation Average:69.532; most accessible tissue: Callus, score: 90.775 N N N N
vg1126193023 G -> A LOC_Os11g43390.1 downstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:69.532; most accessible tissue: Callus, score: 90.775 N N N N
vg1126193023 G -> A LOC_Os11g43380-LOC_Os11g43390 intergenic_region ; MODIFIER silent_mutation Average:69.532; most accessible tissue: Callus, score: 90.775 N N N N
vg1126193023 G -> DEL N N silent_mutation Average:69.532; most accessible tissue: Callus, score: 90.775 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126193023 NA 3.49E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126193023 5.98E-07 2.32E-11 mr1519_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251