Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126193023:

Variant ID: vg1126193023 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 26193023
Reference Allele: G	Alternative Allele: A,GTATATT
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGACAAGTTTGCCCTTTTTAAGTTTATACTGCAGTATCATTACGTAGGGAGATAAATCAATCTACACTGTTAGATTGTTTATACTACAAGTATATACT[G/A,GTATATT]
GTAGTATATTGTACCGTAAAAGTTCTCTATGATCTCCCGAGGTAGAGTCCATTGATCAGCAAGGCTAGCTAGCAGCTAGTATATGGGTAGCGTGCAAGCT

Reverse complement sequence

AGCTTGCACGCTACCCATATACTAGCTGCTAGCTAGCCTTGCTGATCAATGGACTCTACCTCGGGAGATCATAGAGAACTTTTACGGTACAATATACTAC[C/T,AATATAC]
AGTATATACTTGTAGTATAAACAATCTAACAGTGTAGATTGATTTATCTCCCTACGTAATGATACTGCAGTATAAACTTAAAAAGGGCAAACTTGTCTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	10.30%	3.17%	32.67%	GTATATT: 0.11%
All Indica	2759	38.30%	14.90%	4.20%	42.37%	GTATATT: 0.18%
All Japonica	1512	83.70%	3.20%	1.59%	11.51%	NA
Aus	269	43.50%	9.30%	2.60%	44.61%	NA
Indica I	595	23.70%	21.00%	3.70%	51.60%	NA
Indica II	465	66.00%	2.60%	3.66%	27.74%	NA
Indica III	913	29.70%	20.80%	3.94%	45.02%	GTATATT: 0.55%
Indica Intermediate	786	43.10%	10.70%	5.22%	40.97%	NA
Temperate Japonica	767	96.20%	0.40%	0.26%	3.13%	NA
Tropical Japonica	504	72.80%	1.60%	1.79%	23.81%	NA
Japonica Intermediate	241	66.80%	15.40%	5.39%	12.45%	NA
VI/Aromatic	96	52.10%	0.00%	0.00%	47.92%	NA
Intermediate	90	52.20%	5.60%	3.33%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126193023	G -> GTATATT	LOC_Os11g43380.1	upstream_gene_variant ; 2240.0bp to feature; MODIFIER	silent_mutation	Average:69.532; most accessible tissue: Callus, score: 90.775	N	N	N	N
vg1126193023	G -> GTATATT	LOC_Os11g43390.1	downstream_gene_variant ; 2106.0bp to feature; MODIFIER	silent_mutation	Average:69.532; most accessible tissue: Callus, score: 90.775	N	N	N	N
vg1126193023	G -> GTATATT	LOC_Os11g43380-LOC_Os11g43390	intergenic_region ; MODIFIER	silent_mutation	Average:69.532; most accessible tissue: Callus, score: 90.775	N	N	N	N
vg1126193023	G -> A	LOC_Os11g43380.1	upstream_gene_variant ; 2239.0bp to feature; MODIFIER	silent_mutation	Average:69.532; most accessible tissue: Callus, score: 90.775	N	N	N	N
vg1126193023	G -> A	LOC_Os11g43390.1	downstream_gene_variant ; 2107.0bp to feature; MODIFIER	silent_mutation	Average:69.532; most accessible tissue: Callus, score: 90.775	N	N	N	N
vg1126193023	G -> A	LOC_Os11g43380-LOC_Os11g43390	intergenic_region ; MODIFIER	silent_mutation	Average:69.532; most accessible tissue: Callus, score: 90.775	N	N	N	N
vg1126193023	G -> DEL	N	N	silent_mutation	Average:69.532; most accessible tissue: Callus, score: 90.775	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126193023	NA	3.49E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126193023	5.98E-07	2.32E-11	mr1519_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251