Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126138571:

Variant ID: vg1126138571 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26138571
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, C: 0.16, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTGTCCTCTTATGCATCCGATTCGGTCGGTTTGGGAGAGACGGACGAAGGAAGCGTAGAGGGCGGAGGGGATCATGACTTCGTGAACAAAGCGGAAGG[G/C]
GACACTACCACGACGGACGAAAGCGCACAGCGACAAACAAAAGTGCCTTGGCGACGATCGGAAAGTTATGGATTTTTTAAGTATTACTAGCAAAAATGCT

Reverse complement sequence

AGCATTTTTGCTAGTAATACTTAAAAAATCCATAACTTTCCGATCGTCGCCAAGGCACTTTTGTTTGTCGCTGTGCGCTTTCGTCCGTCGTGGTAGTGTC[C/G]
CCTTCCGCTTTGTTCACGAAGTCATGATCCCCTCCGCCCTCTACGCTTCCTTCGTCCGTCTCTCCCAAACCGACCGAATCGGATGCATAAGAGGACAAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.60%	16.40%	0.32%	54.68%	NA
All Indica	2759	19.70%	4.10%	0.51%	75.64%	NA
All Japonica	1512	43.60%	41.70%	0.00%	14.75%	NA
Aus	269	42.40%	0.70%	0.37%	56.51%	NA
Indica I	595	21.80%	2.90%	0.50%	74.79%	NA
Indica II	465	27.70%	3.90%	1.72%	66.67%	NA
Indica III	913	11.30%	3.20%	0.11%	85.43%	NA
Indica Intermediate	786	23.20%	6.40%	0.25%	70.23%	NA
Temperate Japonica	767	43.80%	53.30%	0.00%	2.87%	NA
Tropical Japonica	504	52.20%	22.60%	0.00%	25.20%	NA
Japonica Intermediate	241	24.90%	44.40%	0.00%	30.71%	NA
VI/Aromatic	96	5.20%	15.60%	0.00%	79.17%	NA
Intermediate	90	32.20%	16.70%	0.00%	51.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126138571	G -> DEL	N	N	silent_mutation	Average:42.064; most accessible tissue: Callus, score: 72.98	N	N	N	N
vg1126138571	G -> C	LOC_Os11g43310.1	upstream_gene_variant ; 634.0bp to feature; MODIFIER	silent_mutation	Average:42.064; most accessible tissue: Callus, score: 72.98	N	N	N	N
vg1126138571	G -> C	LOC_Os11g43320.1	upstream_gene_variant ; 1386.0bp to feature; MODIFIER	silent_mutation	Average:42.064; most accessible tissue: Callus, score: 72.98	N	N	N	N
vg1126138571	G -> C	LOC_Os11g43310-LOC_Os11g43320	intergenic_region ; MODIFIER	silent_mutation	Average:42.064; most accessible tissue: Callus, score: 72.98	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126138571	NA	8.48E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126138571	9.69E-08	NA	mr1862	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126138571	NA	2.53E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126138571	3.21E-06	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251