Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126109948:

Variant ID: vg1126109948 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26109948
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, C: 0.18, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

TGGACTAGGGTATAACCCTGGTCCATGCTTATCACTATCGGGCAGAACTAATACGCTCGATACGGATAACACACATCCGTGACGGGCACAAATAAAAAGC[C/A]
CGATACGGATGACACACATCCGTGACGGGCATCAGTTACAAGCCCGATAGAGATAACCTCATCTCTGACAGGCATTATTTATATGCGCGATAGAGATAAG

Reverse complement sequence

CTTATCTCTATCGCGCATATAAATAATGCCTGTCAGAGATGAGGTTATCTCTATCGGGCTTGTAACTGATGCCCGTCACGGATGTGTGTCATCCGTATCG[G/T]
GCTTTTTATTTGTGCCCGTCACGGATGTGTGTTATCCGTATCGAGCGTATTAGTTCTGCCCGATAGTGATAAGCATGGACCAGGGTTATACCCTAGTCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	20.80%	1.04%	4.00%	NA
All Indica	2759	79.20%	17.60%	0.83%	2.39%	NA
All Japonica	1512	67.40%	25.00%	1.32%	6.28%	NA
Aus	269	61.00%	36.40%	0.37%	2.23%	NA
Indica I	595	92.30%	7.70%	0.00%	0.00%	NA
Indica II	465	69.50%	26.00%	1.72%	2.80%	NA
Indica III	913	76.50%	17.90%	0.88%	4.82%	NA
Indica Intermediate	786	78.10%	19.80%	0.89%	1.15%	NA
Temperate Japonica	767	86.30%	11.50%	0.78%	1.43%	NA
Tropical Japonica	504	36.10%	51.00%	1.79%	11.11%	NA
Japonica Intermediate	241	72.60%	13.70%	2.07%	11.62%	NA
VI/Aromatic	96	75.00%	4.20%	3.12%	17.71%	NA
Intermediate	90	74.40%	17.80%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126109948	C -> A	LOC_Os11g43290.1	upstream_gene_variant ; 4665.0bp to feature; MODIFIER	silent_mutation	Average:42.22; most accessible tissue: Minghui63 young leaf, score: 77.654	N	N	N	N
vg1126109948	C -> A	LOC_Os11g43270.1	downstream_gene_variant ; 2380.0bp to feature; MODIFIER	silent_mutation	Average:42.22; most accessible tissue: Minghui63 young leaf, score: 77.654	N	N	N	N
vg1126109948	C -> A	LOC_Os11g43280.1	downstream_gene_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:42.22; most accessible tissue: Minghui63 young leaf, score: 77.654	N	N	N	N
vg1126109948	C -> A	LOC_Os11g43270-LOC_Os11g43280	intergenic_region ; MODIFIER	silent_mutation	Average:42.22; most accessible tissue: Minghui63 young leaf, score: 77.654	N	N	N	N
vg1126109948	C -> DEL	N	N	silent_mutation	Average:42.22; most accessible tissue: Minghui63 young leaf, score: 77.654	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126109948	9.39E-06	NA	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126109948	8.90E-06	1.33E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126109948	7.48E-06	1.97E-06	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126109948	3.64E-06	NA	mr1715_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126109948	7.41E-06	1.07E-06	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126109948	8.02E-06	NA	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126109948	NA	9.74E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251