Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1126104826:

Variant ID: vg1126104826 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 26104826
Reference Allele: TAlternative Allele: C,TC,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGTACAGACGTACACCTCTGATCAGAGTAAAACTATTCGAATAGTCGTGCCCGCGGTTATGGGCGATCAACCAGATTCACCGTGATTAGTTGAACTCT[T/C,TC,A]
TAATAATTTGACTTAATGGAAATGGTTTAGTTCAGGTGGATGGTTGGGCCTGTCGCAACGTGGTGTAGCGTTGGGCAGTGATGGTTTAATTATGACTAAT

Reverse complement sequence

ATTAGTCATAATTAAACCATCACTGCCCAACGCTACACCACGTTGCGACAGGCCCAACCATCCACCTGAACTAAACCATTTCCATTAAGTCAAATTATTA[A/G,GA,T]
AGAGTTCAACTAATCACGGTGAATCTGGTTGATCGCCCATAACCGCGGGCACGACTATTCGAATAGTTTTACTCTGATCAGAGGTGTACGTCTGTACCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 10.60% 10.33% 18.73% TC: 6.67%
All Indica  2759 39.30% 12.40% 15.11% 23.16% TC: 9.97%
All Japonica  1512 79.10% 6.90% 1.92% 11.71% TC: 0.40%
Aus  269 51.30% 7.80% 12.27% 18.22% TC: 10.41%
Indica I  595 37.00% 4.40% 22.52% 25.55% TC: 10.59%
Indica II  465 40.90% 2.80% 14.41% 25.59% TC: 16.34%
Indica III  913 34.60% 22.20% 11.28% 24.32% TC: 7.56%
Indica Intermediate  786 45.70% 12.80% 14.38% 18.58% TC: 8.52%
Temperate Japonica  767 93.70% 1.20% 0.65% 4.17% TC: 0.26%
Tropical Japonica  504 62.90% 11.90% 3.57% 21.43% TC: 0.20%
Japonica Intermediate  241 66.40% 14.50% 2.49% 15.35% TC: 1.24%
VI/Aromatic  96 62.50% 26.00% 4.17% 4.17% TC: 3.12%
Intermediate  90 65.60% 7.80% 5.56% 17.78% TC: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126104826 T -> TC LOC_Os11g43260.1 upstream_gene_variant ; 743.0bp to feature; MODIFIER silent_mutation Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N
vg1126104826 T -> TC LOC_Os11g43270.1 upstream_gene_variant ; 2088.0bp to feature; MODIFIER silent_mutation Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N
vg1126104826 T -> TC LOC_Os11g43260-LOC_Os11g43270 intergenic_region ; MODIFIER silent_mutation Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N
vg1126104826 T -> A LOC_Os11g43260.1 upstream_gene_variant ; 742.0bp to feature; MODIFIER N Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N
vg1126104826 T -> A LOC_Os11g43270.1 upstream_gene_variant ; 2089.0bp to feature; MODIFIER N Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N
vg1126104826 T -> A LOC_Os11g43260-LOC_Os11g43270 intergenic_region ; MODIFIER N Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N
vg1126104826 T -> DEL N N silent_mutation Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N
vg1126104826 T -> C LOC_Os11g43260.1 upstream_gene_variant ; 742.0bp to feature; MODIFIER silent_mutation Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N
vg1126104826 T -> C LOC_Os11g43270.1 upstream_gene_variant ; 2089.0bp to feature; MODIFIER silent_mutation Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N
vg1126104826 T -> C LOC_Os11g43260-LOC_Os11g43270 intergenic_region ; MODIFIER silent_mutation Average:64.961; most accessible tissue: Minghui63 flag leaf, score: 93.957 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126104826 T A 0.0 0.01 0.0 0.0 0.0 0.0
vg1126104826 T C 0.0 0.01 0.0 0.0 0.0 0.0
vg1126104826 T TC 0.0 0.0 0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126104826 3.44E-07 2.16E-08 Grain_thickness Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1126104826 NA 2.66E-06 Grain_weight Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1126104826 NA 4.12E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126104826 NA 2.78E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126104826 NA 1.30E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126104826 NA 1.07E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251