Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126048564:

Variant ID: vg1126048564 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26048564
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.32, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

GACGTGAAGAGCATGCTTCCTTTCGAGAAAATTTCTTATATGCCATTGAAACTTCACTGGTTTCCTTATATACCATCGAAAAGTAGCTATTTCCTTCTAT[G/A]
CCACTGGGTGAAGTTTTTGTTCCCTTTTATGCCACTACCATCACCATTCTGTTAACCCTCTGTTAAATAGGCTTTGAAATGACAAGTTTACCCTTGATAT

Reverse complement sequence

ATATCAAGGGTAAACTTGTCATTTCAAAGCCTATTTAACAGAGGGTTAACAGAATGGTGATGGTAGTGGCATAAAAGGGAACAAAAACTTCACCCAGTGG[C/T]
ATAGAAGGAAATAGCTACTTTTCGATGGTATATAAGGAAACCAGTGAAGTTTCAATGGCATATAAGAAATTTTCTCGAAAGGAAGCATGCTCTTCACGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.10%	46.80%	0.17%	3.94%	NA
All Indica	2759	21.80%	71.20%	0.29%	6.71%	NA
All Japonica	1512	94.20%	5.80%	0.00%	0.00%	NA
Aus	269	70.60%	29.40%	0.00%	0.00%	NA
Indica I	595	8.10%	91.80%	0.17%	0.00%	NA
Indica II	465	17.00%	82.40%	0.00%	0.65%	NA
Indica III	913	25.50%	56.50%	0.44%	17.52%	NA
Indica Intermediate	786	30.80%	66.00%	0.38%	2.80%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	87.90%	12.10%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	58.30%	41.70%	0.00%	0.00%	NA
Intermediate	90	54.40%	44.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126048564	G -> A	LOC_Os11g43160.1	downstream_gene_variant ; 3278.0bp to feature; MODIFIER	silent_mutation	Average:53.443; most accessible tissue: Callus, score: 74.862	N	N	N	N
vg1126048564	G -> A	LOC_Os11g43170.1	downstream_gene_variant ; 869.0bp to feature; MODIFIER	silent_mutation	Average:53.443; most accessible tissue: Callus, score: 74.862	N	N	N	N
vg1126048564	G -> A	LOC_Os11g43180.1	downstream_gene_variant ; 942.0bp to feature; MODIFIER	silent_mutation	Average:53.443; most accessible tissue: Callus, score: 74.862	N	N	N	N
vg1126048564	G -> A	LOC_Os11g43170-LOC_Os11g43180	intergenic_region ; MODIFIER	silent_mutation	Average:53.443; most accessible tissue: Callus, score: 74.862	N	N	N	N
vg1126048564	G -> DEL	N	N	silent_mutation	Average:53.443; most accessible tissue: Callus, score: 74.862	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126048564	NA	3.50E-06	mr1573	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126048564	NA	1.85E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126048564	NA	8.82E-06	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126048564	NA	3.37E-17	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126048564	NA	2.21E-14	mr1819	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126048564	NA	9.59E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126048564	NA	1.08E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126048564	NA	5.67E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251