Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126045964:

Variant ID: vg1126045964 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26045964
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

ACCGCAGAGACATAATCCTGACCGCGGCCATTCCAGCAGCAGGATCTTCAACTCCATCCTCATCGCAGGCAAGGAAAGCTTCCGCTCCTGCACCACCGTC[A/G]
CCTCCTGAACCACCGTCACCTCGACATCCGGCGTCACCACCACTGCTTAGGTCACTGCCTCACCAACCTACACCACCACCCTCCCCTTCTCAACAGCCTA

Reverse complement sequence

TAGGCTGTTGAGAAGGGGAGGGTGGTGGTGTAGGTTGGTGAGGCAGTGACCTAAGCAGTGGTGGTGACGCCGGATGTCGAGGTGACGGTGGTTCAGGAGG[T/C]
GACGGTGGTGCAGGAGCGGAAGCTTTCCTTGCCTGCGATGAGGATGGAGTTGAAGATCCTGCTGCTGGAATGGCCGCGGTCAGGATTATGTCTCTGCGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	32.60%	3.03%	0.00%	NA
All Indica	2759	76.60%	18.30%	5.11%	0.00%	NA
All Japonica	1512	46.70%	53.30%	0.00%	0.00%	NA
Aus	269	44.20%	55.80%	0.00%	0.00%	NA
Indica I	595	92.90%	6.70%	0.34%	0.00%	NA
Indica II	465	84.10%	15.50%	0.43%	0.00%	NA
Indica III	913	67.40%	19.80%	12.81%	0.00%	NA
Indica Intermediate	786	70.50%	27.00%	2.54%	0.00%	NA
Temperate Japonica	767	20.90%	79.10%	0.00%	0.00%	NA
Tropical Japonica	504	91.90%	8.10%	0.00%	0.00%	NA
Japonica Intermediate	241	34.40%	65.60%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	63.30%	34.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126045964	A -> G	LOC_Os11g43170.1	upstream_gene_variant ; 155.0bp to feature; MODIFIER	silent_mutation	Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg1126045964	A -> G	LOC_Os11g43150.1	downstream_gene_variant ; 3568.0bp to feature; MODIFIER	silent_mutation	Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg1126045964	A -> G	LOC_Os11g43160.1	downstream_gene_variant ; 678.0bp to feature; MODIFIER	silent_mutation	Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg1126045964	A -> G	LOC_Os11g43180.1	downstream_gene_variant ; 3542.0bp to feature; MODIFIER	silent_mutation	Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg1126045964	A -> G	LOC_Os11g43160-LOC_Os11g43170	intergenic_region ; MODIFIER	silent_mutation	Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126045964	NA	3.56E-07	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	2.59E-06	mr1161	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	7.04E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	3.57E-08	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	5.00E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	4.69E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	4.65E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	2.22E-09	mr1555	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	2.78E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	3.64E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	2.81E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	8.18E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	2.57E-08	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	1.40E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964	NA	3.38E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251