\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126045964:

Variant ID: vg1126045964 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26045964
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGCAGAGACATAATCCTGACCGCGGCCATTCCAGCAGCAGGATCTTCAACTCCATCCTCATCGCAGGCAAGGAAAGCTTCCGCTCCTGCACCACCGTC[A/G]
CCTCCTGAACCACCGTCACCTCGACATCCGGCGTCACCACCACTGCTTAGGTCACTGCCTCACCAACCTACACCACCACCCTCCCCTTCTCAACAGCCTA

Reverse complement sequence

TAGGCTGTTGAGAAGGGGAGGGTGGTGGTGTAGGTTGGTGAGGCAGTGACCTAAGCAGTGGTGGTGACGCCGGATGTCGAGGTGACGGTGGTTCAGGAGG[T/C]
GACGGTGGTGCAGGAGCGGAAGCTTTCCTTGCCTGCGATGAGGATGGAGTTGAAGATCCTGCTGCTGGAATGGCCGCGGTCAGGATTATGTCTCTGCGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 32.60% 3.03% 0.00% NA
All Indica  2759 76.60% 18.30% 5.11% 0.00% NA
All Japonica  1512 46.70% 53.30% 0.00% 0.00% NA
Aus  269 44.20% 55.80% 0.00% 0.00% NA
Indica I  595 92.90% 6.70% 0.34% 0.00% NA
Indica II  465 84.10% 15.50% 0.43% 0.00% NA
Indica III  913 67.40% 19.80% 12.81% 0.00% NA
Indica Intermediate  786 70.50% 27.00% 2.54% 0.00% NA
Temperate Japonica  767 20.90% 79.10% 0.00% 0.00% NA
Tropical Japonica  504 91.90% 8.10% 0.00% 0.00% NA
Japonica Intermediate  241 34.40% 65.60% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126045964 A -> G LOC_Os11g43170.1 upstream_gene_variant ; 155.0bp to feature; MODIFIER silent_mutation Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1126045964 A -> G LOC_Os11g43150.1 downstream_gene_variant ; 3568.0bp to feature; MODIFIER silent_mutation Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1126045964 A -> G LOC_Os11g43160.1 downstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1126045964 A -> G LOC_Os11g43180.1 downstream_gene_variant ; 3542.0bp to feature; MODIFIER silent_mutation Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1126045964 A -> G LOC_Os11g43160-LOC_Os11g43170 intergenic_region ; MODIFIER silent_mutation Average:63.38; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126045964 NA 3.56E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 2.59E-06 mr1161 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 7.04E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 3.57E-08 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 5.00E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 4.69E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 4.65E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 2.22E-09 mr1555 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 2.78E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 3.64E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 2.81E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 8.18E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 2.57E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 1.40E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126045964 NA 3.38E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251