\
| Variant ID: vg1125990989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25990989 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 127. )
GCCTACCACTAGCGTCAACCTCTCTTATAACTTGCACTGTGGTCGGCCATATATTTTGTGACCGGGGATTTGTACTAGACCTACTTGCACTTGTCCCGCC[C/T]
GACATCGACGTATGTTGTTCCTGCGGCAATTCTGCAGCACAAACAGAAGGCAATATTTGCTAAGGGGTGCTAGCTAAAATTTATGTGGTCATGTGGTGAA
TTCACCACATGACCACATAAATTTTAGCTAGCACCCCTTAGCAAATATTGCCTTCTGTTTGTGCTGCAGAATTGCCGCAGGAACAACATACGTCGATGTC[G/A]
GGCGGGACAAGTGCAAGTAGGTCTAGTACAAATCCCCGGTCACAAAATATATGGCCGACCACAGTGCAAGTTATAAGAGAGGTTGACGCTAGTGGTAGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 4.50% | 1.23% | 1.31% | NA |
| All Indica | 2759 | 88.30% | 7.40% | 2.10% | 2.21% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.40% | 17.20% | 0.22% | 0.22% | NA |
| Indica III | 913 | 82.10% | 6.50% | 5.59% | 5.81% | NA |
| Indica Intermediate | 786 | 90.20% | 8.10% | 0.76% | 0.89% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125990989 | C -> T | LOC_Os11g43080.1 | synonymous_variant ; p.Ser20Ser; LOW | synonymous_codon | Average:33.469; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg1125990989 | C -> DEL | LOC_Os11g43080.1 | N | frameshift_variant | Average:33.469; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125990989 | 3.98E-14 | 3.42E-15 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125990989 | 3.80E-07 | 8.11E-08 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125990989 | 3.18E-07 | 2.49E-08 | mr1484 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125990989 | 3.65E-08 | 1.33E-08 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125990989 | 4.85E-06 | 4.85E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125990989 | 7.44E-11 | 2.02E-12 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125990989 | 4.86E-10 | 4.85E-12 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125990989 | 2.15E-11 | 4.55E-12 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125990989 | 9.29E-08 | 4.48E-09 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125990989 | 1.34E-09 | 1.34E-09 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |