\
| Variant ID: vg1125960837 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25960837 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 105. )
GAGGAGATCACAATTATTGAAGGAATGTAAGTGAGGGCCTTGAAATAAAGCAGAACACATATATAATGCATTTACTAGTTGATATCATGCGTTTTGCTAC[A/G]
GGATGTGGATTAATGCACGTTATATGTATATCGATCCTTGTGTGCATTTTACAAACATAAATGCAGAATGAACTAAGATAGTCCTTTATAAGTTAATGAG
CTCATTAACTTATAAAGGACTATCTTAGTTCATTCTGCATTTATGTTTGTAAAATGCACACAAGGATCGATATACATATAACGTGCATTAATCCACATCC[T/C]
GTAGCAAAACGCATGATATCAACTAGTAAATGCATTATATATGTGTTCTGCTTTATTTCAAGGCCCTCACTTACATTCCTTCAATAATTGTGATCTCCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.80% | 34.20% | 0.06% | 2.94% | NA |
| All Indica | 2759 | 45.90% | 49.10% | 0.07% | 4.93% | NA |
| All Japonica | 1512 | 93.20% | 6.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 52.80% | 46.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 59.00% | 40.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 39.10% | 60.60% | 0.00% | 0.22% | NA |
| Indica III | 913 | 32.00% | 54.90% | 0.00% | 13.14% | NA |
| Indica Intermediate | 786 | 56.20% | 41.90% | 0.00% | 1.91% | NA |
| Temperate Japonica | 767 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 35.60% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125960837 | A -> DEL | N | N | silent_mutation | Average:18.829; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg1125960837 | A -> G | LOC_Os11g43040-LOC_Os11g43060 | intergenic_region ; MODIFIER | silent_mutation | Average:18.829; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125960837 | 1.74E-09 | 9.48E-14 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125960837 | 1.54E-11 | 2.34E-11 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125960837 | 7.72E-14 | 1.68E-14 | mr1644 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125960837 | 2.62E-15 | 2.31E-12 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125960837 | 1.62E-14 | 4.39E-20 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125960837 | 6.85E-16 | 4.08E-14 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125960837 | NA | 2.40E-06 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |