\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125945479:

Variant ID: vg1125945479 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25945479
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCATCTAGTGTACTCTTTCCGTTTGACTTTGGTCAAAGCCAAACTACTCTAAATTTAACTATTTTTACAGAAAAAAAGTAATAACATTTTTAACATAA[A/G]
ACAAATATATTATAAAAATAGCAATTAGGTTTTCTTTAAATAGTATTGTGTTTTACTACTTTTTAAGAAACATAGTATAAATACAGACGTAGAAGAGTGG

Reverse complement sequence

CCACTCTTCTACGTCTGTATTTATACTATGTTTCTTAAAAAGTAGTAAAACACAATACTATTTAAAGAAAACCTAATTGCTATTTTTATAATATATTTGT[T/C]
TTATGTTAAAAATGTTATTACTTTTTTTCTGTAAAAATAGTTAAATTTAGAGTAGTTTGGCTTTGACCAAAGTCAAACGGAAAGAGTACACTAGATGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 38.30% 0.72% 1.80% NA
All Indica  2759 66.00% 33.60% 0.40% 0.00% NA
All Japonica  1512 44.00% 48.90% 1.46% 5.62% NA
Aus  269 76.60% 23.40% 0.00% 0.00% NA
Indica I  595 42.00% 57.60% 0.34% 0.00% NA
Indica II  465 83.00% 16.60% 0.43% 0.00% NA
Indica III  913 79.60% 20.40% 0.00% 0.00% NA
Indica Intermediate  786 58.30% 40.80% 0.89% 0.00% NA
Temperate Japonica  767 15.10% 74.40% 0.91% 9.52% NA
Tropical Japonica  504 92.50% 7.10% 0.40% 0.00% NA
Japonica Intermediate  241 34.90% 54.80% 5.39% 4.98% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125945479 A -> DEL N N silent_mutation Average:50.612; most accessible tissue: Callus, score: 78.549 N N N N
vg1125945479 A -> G LOC_Os11g43040.1 upstream_gene_variant ; 4009.0bp to feature; MODIFIER silent_mutation Average:50.612; most accessible tissue: Callus, score: 78.549 N N N N
vg1125945479 A -> G LOC_Os11g43030.1 intron_variant ; MODIFIER silent_mutation Average:50.612; most accessible tissue: Callus, score: 78.549 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125945479 NA 1.28E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125945479 NA 6.65E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 3.34E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 1.17E-08 1.01E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 1.35E-10 1.56E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 3.85E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 2.79E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 1.59E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 9.12E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 2.09E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 1.93E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 2.21E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 1.42E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 2.03E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 5.94E-11 5.07E-11 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 6.10E-11 1.88E-07 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 1.86E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 7.30E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 1.95E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 4.50E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 3.97E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 NA 3.44E-07 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 7.14E-14 6.12E-13 mr1191_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125945479 1.38E-14 1.33E-10 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251