Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125932233:

Variant ID: vg1125932233 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25932233
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, A: 0.17, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AAATAATATTTTCAAATACTAAATGATTTCAACTAAAAAAAGTCATCAACATCAAAGTTGTATAACTCATAAATATCTATAACTTTTATTTTGGTCATTT[C/A]
TTTATCCGACGAAGTGATAGTAACATTGTTCATAAATCATATAAGAGATATGTAAATTTTGTAACAATATTACTATCACTTTATCGGATAAAGAAATGAT

Reverse complement sequence

ATCATTTCTTTATCCGATAAAGTGATAGTAATATTGTTACAAAATTTACATATCTCTTATATGATTTATGAACAATGTTACTATCACTTCGTCGGATAAA[G/T]
AAATGACCAAAATAAAAGTTATAGATATTTATGAGTTATACAACTTTGATGTTGATGACTTTTTTTAGTTGAAATCATTTAGTATTTGAAAATATTATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	21.90%	0.61%	10.41%	NA
All Indica	2759	59.70%	28.50%	0.65%	11.16%	NA
All Japonica	1512	80.80%	6.90%	0.60%	11.71%	NA
Aus	269	50.90%	48.00%	0.74%	0.37%	NA
Indica I	595	61.70%	7.90%	1.18%	29.24%	NA
Indica II	465	47.30%	37.60%	1.08%	13.98%	NA
Indica III	913	55.60%	41.20%	0.11%	3.07%	NA
Indica Intermediate	786	70.40%	23.80%	0.64%	5.22%	NA
Temperate Japonica	767	76.50%	2.20%	0.78%	20.47%	NA
Tropical Japonica	504	88.30%	11.30%	0.20%	0.20%	NA
Japonica Intermediate	241	78.40%	12.90%	0.83%	7.88%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	15.60%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125932233	C -> A	LOC_Os11g43020.1	downstream_gene_variant ; 345.0bp to feature; MODIFIER	silent_mutation	Average:32.305; most accessible tissue: Callus, score: 68.974	N	N	N	N
vg1125932233	C -> A	LOC_Os11g43010-LOC_Os11g43020	intergenic_region ; MODIFIER	silent_mutation	Average:32.305; most accessible tissue: Callus, score: 68.974	N	N	N	N
vg1125932233	C -> DEL	N	N	silent_mutation	Average:32.305; most accessible tissue: Callus, score: 68.974	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125932233	3.77E-06	NA	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125932233	1.35E-07	4.79E-07	mr1038_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125932233	5.51E-06	5.51E-06	mr1191_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125932233	9.80E-06	9.80E-06	mr1389_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251