\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125901919:

Variant ID: vg1125901919 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25901919
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATGTCATTTTTCCCCTGGCTTGCTGAGTACGTTAAGTAATCACCCTTGCCCCTTATATCAATATATAGAGTATGAAGATGAAGACGTCGACCCGACCG[C/T]
CAAGGAGTATCTCTAGGAGCAAGCCGAGTATGAAGACTTCTAGATGTTTCGTGCCTAGCCCCAAGCCTCGCCTGTGGAATAAGATAGATGCCTAGGTTCT

Reverse complement sequence

AGAACCTAGGCATCTATCTTATTCCACAGGCGAGGCTTGGGGCTAGGCACGAAACATCTAGAAGTCTTCATACTCGGCTTGCTCCTAGAGATACTCCTTG[G/A]
CGGTCGGGTCGACGTCTTCATCTTCATACTCTATATATTGATATAAGGGGCAAGGGTGATTACTTAACGTACTCAGCAAGCCAGGGGAAAAATGACATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 5.80% 0.95% 0.00% NA
All Indica  2759 88.80% 9.50% 1.63% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 71.60% 27.20% 1.18% 0.00% NA
Indica II  465 84.30% 14.40% 1.29% 0.00% NA
Indica III  913 97.00% 0.30% 2.63% 0.00% NA
Indica Intermediate  786 95.00% 3.90% 1.02% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125901919 C -> T LOC_Os11g42970.1 upstream_gene_variant ; 4700.0bp to feature; MODIFIER silent_mutation Average:52.453; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1125901919 C -> T LOC_Os11g42980.1 upstream_gene_variant ; 3177.0bp to feature; MODIFIER silent_mutation Average:52.453; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1125901919 C -> T LOC_Os11g42970-LOC_Os11g42980 intergenic_region ; MODIFIER silent_mutation Average:52.453; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125901919 2.64E-06 1.65E-14 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 1.13E-06 8.50E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 2.54E-07 2.54E-07 mr1440 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 2.71E-06 6.76E-16 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 NA 2.17E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 NA 1.43E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 NA 6.12E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 NA 5.97E-20 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 NA 3.72E-15 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 NA 5.11E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901919 NA 4.15E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251