Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125889993:

Variant ID: vg1125889993 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25889993
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.21, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATTGCAAACTGGGGTTGAATAAATGGATTATTATTTTGTTTTATTCCTCCTACTCCCTTTTTTTATGATGCAGACTCTTTAGTCAATGGCTGCACAG[G/A]
AACAAATTAATCAGGCAATTAACCTAACTTTCTTTTTCTGAAAATTAAATTCGGTTAACAACTTTAACTTGGAAATTTATTAATTCCTAGGAAGATTTGT

Reverse complement sequence

ACAAATCTTCCTAGGAATTAATAAATTTCCAAGTTAAAGTTGTTAACCGAATTTAATTTTCAGAAAAAGAAAGTTAGGTTAATTGCCTGATTAATTTGTT[C/T]
CTGTGCAGCCATTGACTAAAGAGTCTGCATCATAAAAAAAGGGAGTAGGAGGAATAAAACAAAATAATAATCCATTTATTCAACCCCAGTTTGCAATTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 35.50% 0.19% 0.00% NA
All Indica  2759 67.30% 32.50% 0.22% 0.00% NA
All Japonica  1512 53.40% 46.40% 0.20% 0.00% NA
Aus  269 82.20% 17.80% 0.00% 0.00% NA
Indica I  595 90.90% 9.10% 0.00% 0.00% NA
Indica II  465 82.80% 16.80% 0.43% 0.00% NA
Indica III  913 44.60% 55.20% 0.22% 0.00% NA
Indica Intermediate  786 66.70% 33.10% 0.25% 0.00% NA
Temperate Japonica  767 79.70% 20.20% 0.13% 0.00% NA
Tropical Japonica  504 13.50% 86.30% 0.20% 0.00% NA
Japonica Intermediate  241 53.50% 46.10% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125889993 G -> A LOC_Os11g42940.1 upstream_gene_variant ; 2600.0bp to feature; MODIFIER silent_mutation Average:69.088; most accessible tissue: Minghui63 root, score: 98.017 N N N N
vg1125889993 G -> A LOC_Os11g42950.1 downstream_gene_variant ; 524.0bp to feature; MODIFIER silent_mutation Average:69.088; most accessible tissue: Minghui63 root, score: 98.017 N N N N
vg1125889993 G -> A LOC_Os11g42960.1 downstream_gene_variant ; 3726.0bp to feature; MODIFIER silent_mutation Average:69.088; most accessible tissue: Minghui63 root, score: 98.017 N N N N
vg1125889993 G -> A LOC_Os11g42940-LOC_Os11g42950 intergenic_region ; MODIFIER silent_mutation Average:69.088; most accessible tissue: Minghui63 root, score: 98.017 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125889993 G A -0.04 -0.08 -0.07 -0.03 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125889993 NA 7.88E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 9.02E-10 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 2.93E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 9.57E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 8.38E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 1.51E-06 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 2.91E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 5.82E-06 mr1653 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 7.86E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 5.35E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 2.15E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 1.38E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 9.42E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 7.80E-06 NA mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 8.59E-06 NA mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 4.74E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125889993 NA 1.40E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251