\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125885060:

Variant ID: vg1125885060 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25885060
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGATTACGACGACAGCGGCAGCACAGAGGAGGATTACGGCGACAGCGGCAGCACAGAGGAGGTAGATGCACGGAGTGGGAGGAGGAGACGGCGGTGG[T/C]
GGTGGCACTGCTTGGGGAAGAAGCCGGGGCACAGAGTAGGGGTGGTAATGATGCTACTTGGGGAACGAGCCAAGGAAAGGAGTTGTGGCGCGGAGTAGGG

Reverse complement sequence

CCCTACTCCGCGCCACAACTCCTTTCCTTGGCTCGTTCCCCAAGTAGCATCATTACCACCCCTACTCTGTGCCCCGGCTTCTTCCCCAAGCAGTGCCACC[A/G]
CCACCGCCGTCTCCTCCTCCCACTCCGTGCATCTACCTCCTCTGTGCTGCCGCTGTCGCCGTAATCCTCCTCTGTGCTGCCGCTGTCGTCGTAATCCAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 24.40% 0.02% 0.00% NA
All Indica  2759 84.40% 15.60% 0.00% 0.00% NA
All Japonica  1512 60.80% 39.20% 0.00% 0.00% NA
Aus  269 77.00% 22.70% 0.37% 0.00% NA
Indica I  595 55.60% 44.40% 0.00% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 95.10% 4.90% 0.00% 0.00% NA
Indica Intermediate  786 87.80% 12.20% 0.00% 0.00% NA
Temperate Japonica  767 38.90% 61.10% 0.00% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 60.20% 39.80% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125885060 T -> C LOC_Os11g42930.1 upstream_gene_variant ; 2857.0bp to feature; MODIFIER silent_mutation Average:72.486; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg1125885060 T -> C LOC_Os11g42940.1 downstream_gene_variant ; 1403.0bp to feature; MODIFIER silent_mutation Average:72.486; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg1125885060 T -> C LOC_Os11g42930-LOC_Os11g42940 intergenic_region ; MODIFIER silent_mutation Average:72.486; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125885060 NA 6.96E-16 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125885060 NA 1.67E-07 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 3.08E-06 NA mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 1.26E-08 4.44E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 1.20E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 1.11E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 9.78E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 8.19E-08 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 3.95E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 4.05E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 5.23E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 2.00E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 3.92E-07 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 5.86E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 1.58E-07 3.60E-11 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 1.41E-10 4.74E-09 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 6.06E-06 3.00E-10 mr1937 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 4.77E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 NA 1.81E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 2.45E-09 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885060 1.25E-11 1.36E-08 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251