\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125881170:

Variant ID: vg1125881170 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25881170
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.27, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTGTTCATTCCTTTCATAAGGAGAAGGTGTCAGCTTAGACACCCTTATGGCCAGATGTCACAACGCTACTTCCTGGCCAGGTTGAAAAAGCATTCAG[T/C]
GCAGAACACCTCTAACTCTCTAAGCGCTTATAATCCCAATAGCCAATCAAAATATCTCAGCGCCCAGAAATCACCACTCGGCAGGAGCACAACATGTCAT

Reverse complement sequence

ATGACATGTTGTGCTCCTGCCGAGTGGTGATTTCTGGGCGCTGAGATATTTTGATTGGCTATTGGGATTATAAGCGCTTAGAGAGTTAGAGGTGTTCTGC[A/G]
CTGAATGCTTTTTCAACCTGGCCAGGAAGTAGCGTTGTGACATCTGGCCATAAGGGTGTCTAAGCTGACACCTTCTCCTTATGAAAGGAATGAACAAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 24.50% 0.34% 0.00% NA
All Indica  2759 66.00% 33.80% 0.25% 0.00% NA
All Japonica  1512 88.20% 11.70% 0.13% 0.00% NA
Aus  269 89.60% 8.20% 2.23% 0.00% NA
Indica I  595 50.40% 49.10% 0.50% 0.00% NA
Indica II  465 76.10% 23.90% 0.00% 0.00% NA
Indica III  913 71.70% 28.10% 0.11% 0.00% NA
Indica Intermediate  786 65.00% 34.60% 0.38% 0.00% NA
Temperate Japonica  767 79.90% 19.90% 0.13% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.40% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125881170 T -> C LOC_Os11g42930.1 intron_variant ; MODIFIER silent_mutation Average:50.231; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125881170 NA 7.86E-13 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 4.78E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 6.32E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 2.01E-08 9.14E-17 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 1.32E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 2.10E-11 3.92E-26 mr1191_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 2.59E-07 3.19E-16 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 1.10E-07 1.10E-07 mr1191_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 7.99E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 2.73E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 8.85E-06 mr1474_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 2.29E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 1.06E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 7.20E-07 9.36E-11 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 3.03E-08 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 7.27E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 5.32E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125881170 NA 3.83E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251