\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125876512:

Variant ID: vg1125876512 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25876512
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.43, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTTTGTTATCTCTACTATTATAAAAATTAAAGATGTTTTTGCCGGTACTTTGGTACGTCATCCGTGTATAAGTCGGTTTTTAAGTTCGTTCGCTTTT[G/A]
CAAATAAATCTCTGTATTTGAATCAGTTTTTAGGTTTGTTCGTTTTTGAAAATACAAAATGAGTCGTATAAGAAATCTCTTTGAAAAAACTCGCATGCTA

Reverse complement sequence

TAGCATGCGAGTTTTTTCAAAGAGATTTCTTATACGACTCATTTTGTATTTTCAAAAACGAACAAACCTAAAAACTGATTCAAATACAGAGATTTATTTG[C/T]
AAAAGCGAACGAACTTAAAAACCGACTTATACACGGATGACGTACCAAAGTACCGGCAAAAACATCTTTAATTTTTATAATAGTAGAGATAACAAAATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.00% 25.90% 0.99% 35.19% NA
All Indica  2759 54.50% 17.10% 1.20% 27.11% NA
All Japonica  1512 11.40% 39.70% 0.46% 48.35% NA
Aus  269 26.80% 27.90% 1.49% 43.87% NA
Indica I  595 53.30% 43.00% 0.34% 3.36% NA
Indica II  465 36.10% 9.90% 1.94% 52.04% NA
Indica III  913 61.70% 7.10% 1.10% 30.12% NA
Indica Intermediate  786 58.10% 13.50% 1.53% 26.84% NA
Temperate Japonica  767 7.40% 61.40% 0.39% 30.77% NA
Tropical Japonica  504 18.30% 6.30% 0.60% 74.80% NA
Japonica Intermediate  241 10.00% 40.70% 0.41% 48.96% NA
VI/Aromatic  96 3.10% 53.10% 1.04% 42.71% NA
Intermediate  90 45.60% 24.40% 2.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125876512 G -> A LOC_Os11g42920.1 upstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268 N N N N
vg1125876512 G -> A LOC_Os11g42930.1 downstream_gene_variant ; 1255.0bp to feature; MODIFIER silent_mutation Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268 N N N N
vg1125876512 G -> A LOC_Os11g42920-LOC_Os11g42930 intergenic_region ; MODIFIER silent_mutation Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268 N N N N
vg1125876512 G -> DEL N N silent_mutation Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125876512 1.41E-09 5.95E-15 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512 7.65E-06 3.59E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512 9.67E-13 5.18E-21 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512 1.37E-07 3.72E-13 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512 3.36E-06 3.36E-06 mr1644 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512 6.88E-10 3.95E-22 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512 5.98E-08 1.81E-14 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512 NA 5.99E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876512 NA 9.33E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251