\
| Variant ID: vg1125876512 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25876512 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.43, others allele: 0.00, population size: 74. )
CTATTTTGTTATCTCTACTATTATAAAAATTAAAGATGTTTTTGCCGGTACTTTGGTACGTCATCCGTGTATAAGTCGGTTTTTAAGTTCGTTCGCTTTT[G/A]
CAAATAAATCTCTGTATTTGAATCAGTTTTTAGGTTTGTTCGTTTTTGAAAATACAAAATGAGTCGTATAAGAAATCTCTTTGAAAAAACTCGCATGCTA
TAGCATGCGAGTTTTTTCAAAGAGATTTCTTATACGACTCATTTTGTATTTTCAAAAACGAACAAACCTAAAAACTGATTCAAATACAGAGATTTATTTG[C/T]
AAAAGCGAACGAACTTAAAAACCGACTTATACACGGATGACGTACCAAAGTACCGGCAAAAACATCTTTAATTTTTATAATAGTAGAGATAACAAAATAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.00% | 25.90% | 0.99% | 35.19% | NA |
| All Indica | 2759 | 54.50% | 17.10% | 1.20% | 27.11% | NA |
| All Japonica | 1512 | 11.40% | 39.70% | 0.46% | 48.35% | NA |
| Aus | 269 | 26.80% | 27.90% | 1.49% | 43.87% | NA |
| Indica I | 595 | 53.30% | 43.00% | 0.34% | 3.36% | NA |
| Indica II | 465 | 36.10% | 9.90% | 1.94% | 52.04% | NA |
| Indica III | 913 | 61.70% | 7.10% | 1.10% | 30.12% | NA |
| Indica Intermediate | 786 | 58.10% | 13.50% | 1.53% | 26.84% | NA |
| Temperate Japonica | 767 | 7.40% | 61.40% | 0.39% | 30.77% | NA |
| Tropical Japonica | 504 | 18.30% | 6.30% | 0.60% | 74.80% | NA |
| Japonica Intermediate | 241 | 10.00% | 40.70% | 0.41% | 48.96% | NA |
| VI/Aromatic | 96 | 3.10% | 53.10% | 1.04% | 42.71% | NA |
| Intermediate | 90 | 45.60% | 24.40% | 2.22% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125876512 | G -> A | LOC_Os11g42920.1 | upstream_gene_variant ; 420.0bp to feature; MODIFIER | silent_mutation | Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268 | N | N | N | N |
| vg1125876512 | G -> A | LOC_Os11g42930.1 | downstream_gene_variant ; 1255.0bp to feature; MODIFIER | silent_mutation | Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268 | N | N | N | N |
| vg1125876512 | G -> A | LOC_Os11g42920-LOC_Os11g42930 | intergenic_region ; MODIFIER | silent_mutation | Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268 | N | N | N | N |
| vg1125876512 | G -> DEL | N | N | silent_mutation | Average:30.124; most accessible tissue: Minghui63 flower, score: 42.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125876512 | 1.41E-09 | 5.95E-15 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876512 | 7.65E-06 | 3.59E-09 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876512 | 9.67E-13 | 5.18E-21 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876512 | 1.37E-07 | 3.72E-13 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876512 | 3.36E-06 | 3.36E-06 | mr1644 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876512 | 6.88E-10 | 3.95E-22 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876512 | 5.98E-08 | 1.81E-14 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876512 | NA | 5.99E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876512 | NA | 9.33E-06 | mr1579_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |