\
| Variant ID: vg1125876443 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25876443 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.37, others allele: 0.00, population size: 76. )
GGCAAAAAAAAAAGACGACTGACAAAAAGGTAAGGGAAAAATGGCGAAAAAAGACGGATGAAGTCTTTCCTATTTTGTTATCTCTACTATTATAAAAATT[A/G]
AAGATGTTTTTGCCGGTACTTTGGTACGTCATCCGTGTATAAGTCGGTTTTTAAGTTCGTTCGCTTTTGCAAATAAATCTCTGTATTTGAATCAGTTTTT
AAAAACTGATTCAAATACAGAGATTTATTTGCAAAAGCGAACGAACTTAAAAACCGACTTATACACGGATGACGTACCAAAGTACCGGCAAAAACATCTT[T/C]
AATTTTTATAATAGTAGAGATAACAAAATAGGAAAGACTTCATCCGTCTTTTTTCGCCATTTTTCCCTTACCTTTTTGTCAGTCGTCTTTTTTTTTTGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 31.10% | 0.93% | 35.32% | NA |
| All Indica | 2759 | 28.00% | 43.50% | 1.23% | 27.29% | NA |
| All Japonica | 1512 | 40.70% | 10.90% | 0.07% | 48.28% | NA |
| Aus | 269 | 25.30% | 27.90% | 2.60% | 44.24% | NA |
| Indica I | 595 | 76.10% | 20.30% | 0.00% | 3.53% | NA |
| Indica II | 465 | 24.30% | 19.80% | 3.44% | 52.47% | NA |
| Indica III | 913 | 7.40% | 61.60% | 1.20% | 29.79% | NA |
| Indica Intermediate | 786 | 17.70% | 53.90% | 0.89% | 27.48% | NA |
| Temperate Japonica | 767 | 62.50% | 6.50% | 0.00% | 31.03% | NA |
| Tropical Japonica | 504 | 6.90% | 18.30% | 0.20% | 74.60% | NA |
| Japonica Intermediate | 241 | 42.30% | 9.50% | 0.00% | 48.13% | NA |
| VI/Aromatic | 96 | 53.10% | 3.10% | 1.04% | 42.71% | NA |
| Intermediate | 90 | 36.70% | 33.30% | 1.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125876443 | A -> DEL | N | N | silent_mutation | Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg1125876443 | A -> G | LOC_Os11g42920.1 | upstream_gene_variant ; 351.0bp to feature; MODIFIER | silent_mutation | Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg1125876443 | A -> G | LOC_Os11g42930.1 | downstream_gene_variant ; 1324.0bp to feature; MODIFIER | silent_mutation | Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg1125876443 | A -> G | LOC_Os11g42920-LOC_Os11g42930 | intergenic_region ; MODIFIER | silent_mutation | Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125876443 | NA | 4.52E-07 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876443 | 2.72E-06 | 3.43E-17 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876443 | 6.76E-06 | 6.76E-06 | mr1644 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876443 | NA | 4.61E-08 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876443 | NA | 3.19E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876443 | 2.08E-06 | 2.19E-17 | mr1133_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876443 | NA | 1.67E-13 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876443 | 8.06E-06 | 5.34E-06 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876443 | 3.28E-07 | 1.68E-13 | mr1667_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125876443 | NA | 1.74E-09 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |