\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125876443:

Variant ID: vg1125876443 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25876443
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.37, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAAAAAAAAAAGACGACTGACAAAAAGGTAAGGGAAAAATGGCGAAAAAAGACGGATGAAGTCTTTCCTATTTTGTTATCTCTACTATTATAAAAATT[A/G]
AAGATGTTTTTGCCGGTACTTTGGTACGTCATCCGTGTATAAGTCGGTTTTTAAGTTCGTTCGCTTTTGCAAATAAATCTCTGTATTTGAATCAGTTTTT

Reverse complement sequence

AAAAACTGATTCAAATACAGAGATTTATTTGCAAAAGCGAACGAACTTAAAAACCGACTTATACACGGATGACGTACCAAAGTACCGGCAAAAACATCTT[T/C]
AATTTTTATAATAGTAGAGATAACAAAATAGGAAAGACTTCATCCGTCTTTTTTCGCCATTTTTCCCTTACCTTTTTGTCAGTCGTCTTTTTTTTTTGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.60% 31.10% 0.93% 35.32% NA
All Indica  2759 28.00% 43.50% 1.23% 27.29% NA
All Japonica  1512 40.70% 10.90% 0.07% 48.28% NA
Aus  269 25.30% 27.90% 2.60% 44.24% NA
Indica I  595 76.10% 20.30% 0.00% 3.53% NA
Indica II  465 24.30% 19.80% 3.44% 52.47% NA
Indica III  913 7.40% 61.60% 1.20% 29.79% NA
Indica Intermediate  786 17.70% 53.90% 0.89% 27.48% NA
Temperate Japonica  767 62.50% 6.50% 0.00% 31.03% NA
Tropical Japonica  504 6.90% 18.30% 0.20% 74.60% NA
Japonica Intermediate  241 42.30% 9.50% 0.00% 48.13% NA
VI/Aromatic  96 53.10% 3.10% 1.04% 42.71% NA
Intermediate  90 36.70% 33.30% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125876443 A -> DEL N N silent_mutation Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1125876443 A -> G LOC_Os11g42920.1 upstream_gene_variant ; 351.0bp to feature; MODIFIER silent_mutation Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1125876443 A -> G LOC_Os11g42930.1 downstream_gene_variant ; 1324.0bp to feature; MODIFIER silent_mutation Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1125876443 A -> G LOC_Os11g42920-LOC_Os11g42930 intergenic_region ; MODIFIER silent_mutation Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125876443 NA 4.52E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443 2.72E-06 3.43E-17 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443 6.76E-06 6.76E-06 mr1644 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443 NA 4.61E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443 NA 3.19E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443 2.08E-06 2.19E-17 mr1133_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443 NA 1.67E-13 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443 8.06E-06 5.34E-06 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443 3.28E-07 1.68E-13 mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443 NA 1.74E-09 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251