Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125876443:

Variant ID: vg1125876443 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25876443
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.37, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

GGCAAAAAAAAAAGACGACTGACAAAAAGGTAAGGGAAAAATGGCGAAAAAAGACGGATGAAGTCTTTCCTATTTTGTTATCTCTACTATTATAAAAATT[A/G]
AAGATGTTTTTGCCGGTACTTTGGTACGTCATCCGTGTATAAGTCGGTTTTTAAGTTCGTTCGCTTTTGCAAATAAATCTCTGTATTTGAATCAGTTTTT

Reverse complement sequence

AAAAACTGATTCAAATACAGAGATTTATTTGCAAAAGCGAACGAACTTAAAAACCGACTTATACACGGATGACGTACCAAAGTACCGGCAAAAACATCTT[T/C]
AATTTTTATAATAGTAGAGATAACAAAATAGGAAAGACTTCATCCGTCTTTTTTCGCCATTTTTCCCTTACCTTTTTGTCAGTCGTCTTTTTTTTTTGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	31.10%	0.93%	35.32%	NA
All Indica	2759	28.00%	43.50%	1.23%	27.29%	NA
All Japonica	1512	40.70%	10.90%	0.07%	48.28%	NA
Aus	269	25.30%	27.90%	2.60%	44.24%	NA
Indica I	595	76.10%	20.30%	0.00%	3.53%	NA
Indica II	465	24.30%	19.80%	3.44%	52.47%	NA
Indica III	913	7.40%	61.60%	1.20%	29.79%	NA
Indica Intermediate	786	17.70%	53.90%	0.89%	27.48%	NA
Temperate Japonica	767	62.50%	6.50%	0.00%	31.03%	NA
Tropical Japonica	504	6.90%	18.30%	0.20%	74.60%	NA
Japonica Intermediate	241	42.30%	9.50%	0.00%	48.13%	NA
VI/Aromatic	96	53.10%	3.10%	1.04%	42.71%	NA
Intermediate	90	36.70%	33.30%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125876443	A -> DEL	N	N	silent_mutation	Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1125876443	A -> G	LOC_Os11g42920.1	upstream_gene_variant ; 351.0bp to feature; MODIFIER	silent_mutation	Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1125876443	A -> G	LOC_Os11g42930.1	downstream_gene_variant ; 1324.0bp to feature; MODIFIER	silent_mutation	Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1125876443	A -> G	LOC_Os11g42920-LOC_Os11g42930	intergenic_region ; MODIFIER	silent_mutation	Average:27.907; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125876443	NA	4.52E-07	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443	2.72E-06	3.43E-17	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443	6.76E-06	6.76E-06	mr1644	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443	NA	4.61E-08	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443	NA	3.19E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443	2.08E-06	2.19E-17	mr1133_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443	NA	1.67E-13	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443	8.06E-06	5.34E-06	mr1332_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443	3.28E-07	1.68E-13	mr1667_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125876443	NA	1.74E-09	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251