\
| Variant ID: vg1125875287 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25875287 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGATAAAACAAAGTCACAAGAAAAAATGGCCAAAATAGTACTAGTAAGAACACAATAACATGATAGAGCATGATTTTAGAAACATTTAGGAAAAAGAAT[A/C]
ATCCAATTTAAAGTTCATATGAGTGAGATACACTAGTTTTAATTTTTTTAAATTTTTCAAATTTTATTTTCGCATATGGCTCCTTAAGACACCTGTATGG
CCATACAGGTGTCTTAAGGAGCCATATGCGAAAATAAAATTTGAAAAATTTAAAAAAATTAAAACTAGTGTATCTCACTCATATGAACTTTAAATTGGAT[T/G]
ATTCTTTTTCCTAAATGTTTCTAAAATCATGCTCTATCATGTTATTGTGTTCTTACTAGTACTATTTTGGCCATTTTTTCTTGTGACTTTGTTTTATCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.30% | 24.30% | 0.25% | 37.11% | NA |
| All Indica | 2759 | 55.10% | 15.00% | 0.22% | 29.72% | NA |
| All Japonica | 1512 | 11.40% | 39.70% | 0.20% | 48.61% | NA |
| Aus | 269 | 27.50% | 23.00% | 0.37% | 49.07% | NA |
| Indica I | 595 | 53.40% | 42.70% | 0.50% | 3.36% | NA |
| Indica II | 465 | 36.60% | 5.40% | 0.43% | 57.63% | NA |
| Indica III | 913 | 61.90% | 5.10% | 0.00% | 32.97% | NA |
| Indica Intermediate | 786 | 59.40% | 11.10% | 0.13% | 29.39% | NA |
| Temperate Japonica | 767 | 7.60% | 61.40% | 0.13% | 30.90% | NA |
| Tropical Japonica | 504 | 18.30% | 6.20% | 0.20% | 75.40% | NA |
| Japonica Intermediate | 241 | 9.50% | 41.10% | 0.41% | 48.96% | NA |
| VI/Aromatic | 96 | 3.10% | 52.10% | 0.00% | 44.79% | NA |
| Intermediate | 90 | 46.70% | 24.40% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125875287 | A -> DEL | N | N | silent_mutation | Average:26.536; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg1125875287 | A -> C | LOC_Os11g42930.1 | downstream_gene_variant ; 2480.0bp to feature; MODIFIER | silent_mutation | Average:26.536; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg1125875287 | A -> C | LOC_Os11g42920.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.536; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125875287 | NA | 8.08E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | 4.40E-07 | 3.82E-11 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | 5.75E-08 | 1.92E-08 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | NA | 9.58E-08 | mr1332 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | NA | 3.59E-06 | mr1380 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | NA | 5.04E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | NA | 1.47E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | NA | 2.44E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | 1.58E-07 | 1.54E-13 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | 5.05E-08 | 4.79E-09 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | NA | 5.93E-09 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | NA | 2.82E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | 1.85E-06 | 1.39E-14 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | 8.02E-08 | 6.91E-09 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125875287 | NA | 5.14E-06 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |