Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125874639:

Variant ID: vg1125874639 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25874639
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, T: 0.47, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

CTAATCAAATTTTATGATATTAAATGAACTCATATGAAAAACTTGCCAAAAACAAAGATGTAGAACTCATTGAGATCTACCAATTTTCTTTTGCTCATTT[C/T]
TGCATCCGAGTTTGATTGAACTATATAAAATTTGAATTTTAAAATGTAAAAAATTCAAAAAAAAATTCGAGTAGTAAATGATTTCAAATGGAAAAGTTGT

Reverse complement sequence

ACAACTTTTCCATTTGAAATCATTTACTACTCGAATTTTTTTTTGAATTTTTTACATTTTAAAATTCAAATTTTATATAGTTCAATCAAACTCGGATGCA[G/A]
AAATGAGCAAAAGAAAATTGGTAGATCTCAATGAGTTCTACATCTTTGTTTTTGGCAAGTTTTTCATATGAGTTCATTTAATATCATAAAATTTGATTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.00%	26.70%	0.55%	36.78%	NA
All Indica	2759	31.70%	38.20%	0.47%	29.58%	NA
All Japonica	1512	44.30%	7.10%	0.60%	48.02%	NA
Aus	269	25.70%	26.00%	0.74%	47.58%	NA
Indica I	595	75.60%	20.30%	0.50%	3.53%	NA
Indica II	465	22.60%	19.40%	0.86%	57.20%	NA
Indica III	913	18.20%	48.60%	0.44%	32.75%	NA
Indica Intermediate	786	19.60%	50.90%	0.25%	29.26%	NA
Temperate Japonica	767	64.40%	4.60%	0.78%	30.25%	NA
Tropical Japonica	504	14.70%	10.30%	0.40%	74.60%	NA
Japonica Intermediate	241	42.30%	8.30%	0.41%	48.96%	NA
VI/Aromatic	96	52.10%	3.10%	0.00%	44.79%	NA
Intermediate	90	40.00%	30.00%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125874639	C -> T	LOC_Os11g42930.1	downstream_gene_variant ; 3128.0bp to feature; MODIFIER	silent_mutation	Average:19.667; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N
vg1125874639	C -> T	LOC_Os11g42920.1	intron_variant ; MODIFIER	silent_mutation	Average:19.667; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N
vg1125874639	C -> DEL	N	N	silent_mutation	Average:19.667; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125874639	NA	6.58E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125874639	NA	1.24E-12	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125874639	3.20E-07	3.20E-07	mr1191	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125874639	6.02E-09	6.01E-09	mr1644	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125874639	NA	2.46E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125874639	NA	1.27E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125874639	NA	4.16E-09	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125874639	1.80E-07	1.80E-07	mr1191_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125874639	NA	5.03E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251