\
| Variant ID: vg1125871704 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25871704 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, C: 0.47, others allele: 0.00, population size: 70. )
TGATGACTTAGGGGCTTACCAAATTTTGGCATTAACACCCCCACCCCCACCGTGTCCCTTTTGTTATGGTTTTCTTCATTGCCAACCTTTACCGTCTATG[G/C]
ATGAGTCACATCGTGGGACACACCCTACCACTTTTCTCACCGTCGTTTGGTCGATGGAGCACCGACACCCATTTTCCCTCCTCTTTTATTTCTCGCATTG
CAATGCGAGAAATAAAAGAGGAGGGAAAATGGGTGTCGGTGCTCCATCGACCAAACGACGGTGAGAAAAGTGGTAGGGTGTGTCCCACGATGTGACTCAT[C/G]
CATAGACGGTAAAGGTTGGCAATGAAGAAAACCATAACAAAAGGGACACGGTGGGGGTGGGGGTGTTAATGCCAAAATTTGGTAAGCCCCTAAGTCATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.60% | 26.80% | 1.29% | 35.29% | NA |
| All Indica | 2759 | 32.80% | 38.30% | 1.59% | 27.29% | NA |
| All Japonica | 1512 | 44.60% | 7.10% | 0.66% | 47.62% | NA |
| Aus | 269 | 25.30% | 26.00% | 1.86% | 46.84% | NA |
| Indica I | 595 | 76.00% | 20.30% | 0.34% | 3.36% | NA |
| Indica II | 465 | 23.70% | 19.40% | 3.01% | 53.98% | NA |
| Indica III | 913 | 20.00% | 48.70% | 1.86% | 29.35% | NA |
| Indica Intermediate | 786 | 20.20% | 51.10% | 1.40% | 27.23% | NA |
| Temperate Japonica | 767 | 64.70% | 4.60% | 0.39% | 30.38% | NA |
| Tropical Japonica | 504 | 14.90% | 10.30% | 0.99% | 73.81% | NA |
| Japonica Intermediate | 241 | 43.20% | 8.30% | 0.83% | 47.72% | NA |
| VI/Aromatic | 96 | 53.10% | 3.10% | 0.00% | 43.75% | NA |
| Intermediate | 90 | 35.60% | 32.20% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125871704 | G -> DEL | N | N | silent_mutation | Average:40.266; most accessible tissue: Callus, score: 72.682 | N | N | N | N |
| vg1125871704 | G -> C | LOC_Os11g42920.1 | downstream_gene_variant ; 2148.0bp to feature; MODIFIER | silent_mutation | Average:40.266; most accessible tissue: Callus, score: 72.682 | N | N | N | N |
| vg1125871704 | G -> C | LOC_Os11g42910-LOC_Os11g42920 | intergenic_region ; MODIFIER | silent_mutation | Average:40.266; most accessible tissue: Callus, score: 72.682 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125871704 | NA | 2.78E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | NA | 6.96E-14 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | 2.03E-10 | 2.03E-10 | mr1191 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | 3.00E-12 | 2.99E-12 | mr1644 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | NA | 2.48E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | NA | 5.76E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | NA | 1.77E-17 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | NA | 1.92E-10 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | 6.74E-12 | 6.74E-12 | mr1191_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | NA | 2.37E-12 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125871704 | NA | 2.93E-07 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |