\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125867297:

Variant ID: vg1125867297 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25867297
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.39, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGTATTCTTTTGACTTGACATCTCTTAAAACTTGTAACACATATTTTGTATTCTAAATGACATCGAATAAATAAGATCGTCAACTACAATTATAGAT[T/C]
GCGTCGAGCCATAGAACTTTGATATAGAGCATATCTCGCTCATTTGAAAAACTCGAAAGATCTCATTAAGAGCTACAATTTTCATATTGAGCGTGTCACC

Reverse complement sequence

GGTGACACGCTCAATATGAAAATTGTAGCTCTTAATGAGATCTTTCGAGTTTTTCAAATGAGCGAGATATGCTCTATATCAAAGTTCTATGGCTCGACGC[A/G]
ATCTATAATTGTAGTTGACGATCTTATTTATTCGATGTCATTTAGAATACAAAATATGTGTTACAAGTTTTAAGAGATGTCAAGTCAAAAGAATACCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.40% 24.10% 1.65% 35.82% NA
All Indica  2759 55.30% 14.70% 0.51% 29.54% NA
All Japonica  1512 11.60% 39.60% 3.90% 44.91% NA
Aus  269 26.80% 24.20% 0.74% 48.33% NA
Indica I  595 53.60% 42.40% 0.67% 3.36% NA
Indica II  465 37.00% 5.40% 0.86% 56.77% NA
Indica III  913 61.90% 4.80% 0.33% 32.97% NA
Indica Intermediate  786 59.70% 10.70% 0.38% 29.26% NA
Temperate Japonica  767 7.70% 61.40% 1.17% 29.73% NA
Tropical Japonica  504 18.50% 5.80% 8.33% 67.46% NA
Japonica Intermediate  241 10.00% 40.70% 3.32% 46.06% NA
VI/Aromatic  96 3.10% 51.00% 1.04% 44.79% NA
Intermediate  90 45.60% 23.30% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125867297 T -> DEL N N silent_mutation Average:37.011; most accessible tissue: Callus, score: 61.903 N N N N
vg1125867297 T -> C LOC_Os11g42910.1 downstream_gene_variant ; 1061.0bp to feature; MODIFIER silent_mutation Average:37.011; most accessible tissue: Callus, score: 61.903 N N N N
vg1125867297 T -> C LOC_Os11g42910-LOC_Os11g42920 intergenic_region ; MODIFIER silent_mutation Average:37.011; most accessible tissue: Callus, score: 61.903 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125867297 NA 7.00E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 1.12E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 2.40E-08 1.97E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 7.74E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 5.54E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 1.33E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 2.23E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 4.89E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 2.68E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 1.02E-06 9.28E-13 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 1.38E-09 1.56E-09 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 2.00E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 1.27E-08 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 6.53E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 1.07E-08 2.11E-15 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 1.21E-11 3.73E-10 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125867297 NA 9.25E-08 mr1338_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251