\
| Variant ID: vg1125863777 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25863777 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.43, others allele: 0.00, population size: 73. )
ATTTTACTGTTGCTTCTAATAACACCTATATATATTGGCTGCATTTTTCCTTTCATGTAGACACTGTTTGTGGATGTTTGGTGAAGTTGATAGTGTATCT[G/A]
ACAGAGGGGGAATCTTTGCAGAATTAGTTCATGATGTGATAGAGCGAAAGTGTATCTTGAAATGGAACACTATCACTACAATTCAATCAAAATATGCACT
AGTGCATATTTTGATTGAATTGTAGTGATAGTGTTCCATTTCAAGATACACTTTCGCTCTATCACATCATGAACTAATTCTGCAAAGATTCCCCCTCTGT[C/T]
AGATACACTATCAACTTCACCAAACATCCACAAACAGTGTCTACATGAAAGGAAAAATGCAGCCAATATATATAGGTGTTATTAGAAGCAACAGTAAAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.80% | 27.00% | 12.76% | 24.42% | NA |
| All Indica | 2759 | 52.40% | 17.60% | 12.58% | 17.43% | NA |
| All Japonica | 1512 | 8.90% | 42.80% | 12.10% | 36.24% | NA |
| Aus | 269 | 26.00% | 25.70% | 23.05% | 25.28% | NA |
| Indica I | 595 | 53.30% | 43.00% | 1.68% | 2.02% | NA |
| Indica II | 465 | 36.30% | 5.80% | 36.77% | 21.08% | NA |
| Indica III | 913 | 55.40% | 11.40% | 8.11% | 25.08% | NA |
| Indica Intermediate | 786 | 57.60% | 12.60% | 11.70% | 18.07% | NA |
| Temperate Japonica | 767 | 7.80% | 62.20% | 6.13% | 23.86% | NA |
| Tropical Japonica | 504 | 10.30% | 13.50% | 19.25% | 56.94% | NA |
| Japonica Intermediate | 241 | 9.10% | 42.30% | 16.18% | 32.37% | NA |
| VI/Aromatic | 96 | 3.10% | 54.20% | 5.21% | 37.50% | NA |
| Intermediate | 90 | 43.30% | 26.70% | 6.67% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125863777 | G -> A | LOC_Os11g42910.1 | missense_variant ; p.Asp973Asn; MODERATE | nonsynonymous_codon ; D973N | Average:30.827; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | benign |
-1.181 |
TOLERATED | 0.33 |
| vg1125863777 | G -> DEL | LOC_Os11g42910.1 | N | frameshift_variant | Average:30.827; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125863777 | 3.67E-06 | NA | Plant_height | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1125863777 | 5.67E-12 | 1.98E-20 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | 2.33E-07 | 8.92E-11 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | 3.89E-15 | 2.64E-27 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | 1.07E-08 | 7.41E-15 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | 6.27E-08 | 6.27E-08 | mr1644 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | 3.95E-14 | 2.92E-31 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | 2.14E-08 | 6.09E-16 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | 1.02E-07 | 1.02E-07 | mr1191_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | NA | 3.71E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | NA | 3.63E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | NA | 1.70E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | NA | 2.61E-07 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863777 | NA | 6.36E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |