\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125860780:

Variant ID: vg1125860780 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25860780
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGGGGATGCACAGCGGCGTAAGAAGGCAATTGGGGTTGACAACGATGACAGTAATCGAGACGACGCTGATGGAGGACGAGACCCCAACAAGTCTCTTT[C/T]
ATCAGAAATTGTTCTGTCATGGACAATCCAGGATATCTTATTGGATGATGAGGCACACAAAAGCAAGGTATGATATTAATTTGCTTGGGTGTTTTAAATA

Reverse complement sequence

TATTTAAAACACCCAAGCAAATTAATATCATACCTTGCTTTTGTGTGCCTCATCATCCAATAAGATATCCTGGATTGTCCATGACAGAACAATTTCTGAT[G/A]
AAAGAGACTTGTTGGGGTCTCGTCCTCCATCAGCGTCGTCTCGATTACTGTCATCGTTGTCAACCCCAATTGCCTTCTTACGCCGCTGTGCATCCCCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 23.80% 1.46% 36.10% NA
All Indica  2759 55.50% 14.30% 1.99% 28.23% NA
All Japonica  1512 11.50% 39.60% 0.66% 48.28% NA
Aus  269 28.30% 23.40% 0.74% 47.58% NA
Indica I  595 53.40% 42.50% 0.50% 3.53% NA
Indica II  465 36.60% 4.90% 1.72% 56.77% NA
Indica III  913 61.90% 4.80% 3.72% 29.57% NA
Indica Intermediate  786 60.80% 9.40% 1.27% 28.50% NA
Temperate Japonica  767 7.30% 61.80% 0.39% 30.51% NA
Tropical Japonica  504 18.10% 6.00% 1.19% 74.80% NA
Japonica Intermediate  241 11.20% 39.00% 0.41% 49.38% NA
VI/Aromatic  96 3.10% 52.10% 0.00% 44.79% NA
Intermediate  90 47.80% 21.10% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125860780 C -> T LOC_Os11g42910.1 missense_variant ; p.Ser225Leu; MODERATE nonsynonymous_codon ; S225L Average:36.264; most accessible tissue: Callus, score: 72.015 unknown unknown TOLERATED 1.00
vg1125860780 C -> DEL LOC_Os11g42910.1 N frameshift_variant Average:36.264; most accessible tissue: Callus, score: 72.015 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125860780 2.32E-07 1.53E-15 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 5.87E-06 1.49E-10 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 3.81E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 4.51E-06 4.51E-06 mr1469 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 5.90E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 6.05E-06 mr1561 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 1.63E-11 6.24E-25 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 7.20E-08 1.38E-16 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 1.16E-06 mr1875 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 4.40E-06 4.40E-06 mr1908 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 3.99E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 1.78E-07 5.50E-25 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 6.12E-06 1.39E-15 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 5.75E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 5.43E-06 7.93E-07 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 3.27E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 4.54E-07 mr1474_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 1.78E-06 1.78E-06 mr1474_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 2.53E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 3.53E-08 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 2.21E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125860780 NA 2.12E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251