\
| Variant ID: vg1125860780 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25860780 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 80. )
TTTGGGGATGCACAGCGGCGTAAGAAGGCAATTGGGGTTGACAACGATGACAGTAATCGAGACGACGCTGATGGAGGACGAGACCCCAACAAGTCTCTTT[C/T]
ATCAGAAATTGTTCTGTCATGGACAATCCAGGATATCTTATTGGATGATGAGGCACACAAAAGCAAGGTATGATATTAATTTGCTTGGGTGTTTTAAATA
TATTTAAAACACCCAAGCAAATTAATATCATACCTTGCTTTTGTGTGCCTCATCATCCAATAAGATATCCTGGATTGTCCATGACAGAACAATTTCTGAT[G/A]
AAAGAGACTTGTTGGGGTCTCGTCCTCCATCAGCGTCGTCTCGATTACTGTCATCGTTGTCAACCCCAATTGCCTTCTTACGCCGCTGTGCATCCCCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 23.80% | 1.46% | 36.10% | NA |
| All Indica | 2759 | 55.50% | 14.30% | 1.99% | 28.23% | NA |
| All Japonica | 1512 | 11.50% | 39.60% | 0.66% | 48.28% | NA |
| Aus | 269 | 28.30% | 23.40% | 0.74% | 47.58% | NA |
| Indica I | 595 | 53.40% | 42.50% | 0.50% | 3.53% | NA |
| Indica II | 465 | 36.60% | 4.90% | 1.72% | 56.77% | NA |
| Indica III | 913 | 61.90% | 4.80% | 3.72% | 29.57% | NA |
| Indica Intermediate | 786 | 60.80% | 9.40% | 1.27% | 28.50% | NA |
| Temperate Japonica | 767 | 7.30% | 61.80% | 0.39% | 30.51% | NA |
| Tropical Japonica | 504 | 18.10% | 6.00% | 1.19% | 74.80% | NA |
| Japonica Intermediate | 241 | 11.20% | 39.00% | 0.41% | 49.38% | NA |
| VI/Aromatic | 96 | 3.10% | 52.10% | 0.00% | 44.79% | NA |
| Intermediate | 90 | 47.80% | 21.10% | 2.22% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125860780 | C -> T | LOC_Os11g42910.1 | missense_variant ; p.Ser225Leu; MODERATE | nonsynonymous_codon ; S225L | Average:36.264; most accessible tissue: Callus, score: 72.015 | unknown | unknown | TOLERATED | 1.00 |
| vg1125860780 | C -> DEL | LOC_Os11g42910.1 | N | frameshift_variant | Average:36.264; most accessible tissue: Callus, score: 72.015 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125860780 | 2.32E-07 | 1.53E-15 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | 5.87E-06 | 1.49E-10 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 3.81E-06 | mr1380 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | 4.51E-06 | 4.51E-06 | mr1469 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 5.90E-07 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 6.05E-06 | mr1561 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | 1.63E-11 | 6.24E-25 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | 7.20E-08 | 1.38E-16 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 1.16E-06 | mr1875 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | 4.40E-06 | 4.40E-06 | mr1908 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 3.99E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | 1.78E-07 | 5.50E-25 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | 6.12E-06 | 1.39E-15 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 5.75E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | 5.43E-06 | 7.93E-07 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 3.27E-07 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 4.54E-07 | mr1474_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | 1.78E-06 | 1.78E-06 | mr1474_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 2.53E-07 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 3.53E-08 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 2.21E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125860780 | NA | 2.12E-06 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |