| Variant ID: vg1125850665 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25850665 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.32, T: 0.01, others allele: 0.00, population size: 76. )
AAATTTTGTTTTTAACTAACGGAGCCTTATAATACATGGACCTAAGAAGTGACTATTCTAACATAAAAAATTTTTATAGGTGTTCTCGTATAGAAAAATT[G/A,T]
TTTCTATAGTAGTAGTGGTAGGTTAGAAAAGGACTAACGGAACTGTTAAAATACCATCTATTGTGTTTAGATCTAGGGGTGAAAATTTTTGTCGTGTCAC
GTGACACGACAAAAATTTTCACCCCTAGATCTAAACACAATAGATGGTATTTTAACAGTTCCGTTAGTCCTTTTCTAACCTACCACTACTACTATAGAAA[C/T,A]
AATTTTTCTATACGAGAACACCTATAAAAATTTTTTATGTTAGAATAGTCACTTCTTAGGTCCATGTATTATAAGGCTCCGTTAGTTAAAAACAAAATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 42.30% | 0.23% | 0.00% | T: 0.06% |
| All Indica | 2759 | 41.80% | 57.90% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 90.90% | 9.10% | 0.00% | 0.00% | T: 0.07% |
| Aus | 269 | 26.80% | 72.10% | 0.74% | 0.00% | T: 0.37% |
| Indica I | 595 | 80.70% | 18.50% | 0.84% | 0.00% | NA |
| Indica II | 465 | 26.20% | 73.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 36.70% | 63.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 27.50% | 72.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 82.50% | 17.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 12.90% | 0.00% | 0.00% | T: 0.41% |
| VI/Aromatic | 96 | 58.30% | 40.60% | 0.00% | 0.00% | T: 1.04% |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125850665 | G -> T | LOC_Os11g42900.1 | upstream_gene_variant ; 3675.0bp to feature; MODIFIER | silent_mutation | Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1125850665 | G -> T | LOC_Os11g42900-LOC_Os11g42910 | intergenic_region ; MODIFIER | silent_mutation | Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1125850665 | G -> A | LOC_Os11g42900.1 | upstream_gene_variant ; 3675.0bp to feature; MODIFIER | silent_mutation | Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1125850665 | G -> A | LOC_Os11g42900-LOC_Os11g42910 | intergenic_region ; MODIFIER | silent_mutation | Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125850665 | NA | 4.91E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125850665 | NA | 7.02E-07 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125850665 | NA | 1.05E-08 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125850665 | NA | 1.37E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125850665 | NA | 4.00E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125850665 | NA | 1.18E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125850665 | 4.49E-07 | 3.91E-08 | mr1925 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125850665 | NA | 6.06E-07 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125850665 | NA | 1.84E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125850665 | NA | 1.14E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |