\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125850665:

Variant ID: vg1125850665 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25850665
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.32, T: 0.01, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTTTGTTTTTAACTAACGGAGCCTTATAATACATGGACCTAAGAAGTGACTATTCTAACATAAAAAATTTTTATAGGTGTTCTCGTATAGAAAAATT[G/A,T]
TTTCTATAGTAGTAGTGGTAGGTTAGAAAAGGACTAACGGAACTGTTAAAATACCATCTATTGTGTTTAGATCTAGGGGTGAAAATTTTTGTCGTGTCAC

Reverse complement sequence

GTGACACGACAAAAATTTTCACCCCTAGATCTAAACACAATAGATGGTATTTTAACAGTTCCGTTAGTCCTTTTCTAACCTACCACTACTACTATAGAAA[C/T,A]
AATTTTTCTATACGAGAACACCTATAAAAATTTTTTATGTTAGAATAGTCACTTCTTAGGTCCATGTATTATAAGGCTCCGTTAGTTAAAAACAAAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.30% 0.23% 0.00% T: 0.06%
All Indica  2759 41.80% 57.90% 0.33% 0.00% NA
All Japonica  1512 90.90% 9.10% 0.00% 0.00% T: 0.07%
Aus  269 26.80% 72.10% 0.74% 0.00% T: 0.37%
Indica I  595 80.70% 18.50% 0.84% 0.00% NA
Indica II  465 26.20% 73.80% 0.00% 0.00% NA
Indica III  913 36.70% 63.10% 0.22% 0.00% NA
Indica Intermediate  786 27.50% 72.30% 0.25% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 82.50% 17.50% 0.00% 0.00% NA
Japonica Intermediate  241 86.70% 12.90% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 58.30% 40.60% 0.00% 0.00% T: 1.04%
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125850665 G -> T LOC_Os11g42900.1 upstream_gene_variant ; 3675.0bp to feature; MODIFIER silent_mutation Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1125850665 G -> T LOC_Os11g42900-LOC_Os11g42910 intergenic_region ; MODIFIER silent_mutation Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1125850665 G -> A LOC_Os11g42900.1 upstream_gene_variant ; 3675.0bp to feature; MODIFIER silent_mutation Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1125850665 G -> A LOC_Os11g42900-LOC_Os11g42910 intergenic_region ; MODIFIER silent_mutation Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125850665 NA 4.91E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665 NA 7.02E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665 NA 1.05E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665 NA 1.37E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665 NA 4.00E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665 NA 1.18E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665 4.49E-07 3.91E-08 mr1925 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665 NA 6.06E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665 NA 1.84E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665 NA 1.14E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251