Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125850665:

Variant ID: vg1125850665 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25850665
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.32, T: 0.01, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

AAATTTTGTTTTTAACTAACGGAGCCTTATAATACATGGACCTAAGAAGTGACTATTCTAACATAAAAAATTTTTATAGGTGTTCTCGTATAGAAAAATT[G/A,T]
TTTCTATAGTAGTAGTGGTAGGTTAGAAAAGGACTAACGGAACTGTTAAAATACCATCTATTGTGTTTAGATCTAGGGGTGAAAATTTTTGTCGTGTCAC

Reverse complement sequence

GTGACACGACAAAAATTTTCACCCCTAGATCTAAACACAATAGATGGTATTTTAACAGTTCCGTTAGTCCTTTTCTAACCTACCACTACTACTATAGAAA[C/T,A]
AATTTTTCTATACGAGAACACCTATAAAAATTTTTTATGTTAGAATAGTCACTTCTTAGGTCCATGTATTATAAGGCTCCGTTAGTTAAAAACAAAATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	42.30%	0.23%	0.00%	T: 0.06%
All Indica	2759	41.80%	57.90%	0.33%	0.00%	NA
All Japonica	1512	90.90%	9.10%	0.00%	0.00%	T: 0.07%
Aus	269	26.80%	72.10%	0.74%	0.00%	T: 0.37%
Indica I	595	80.70%	18.50%	0.84%	0.00%	NA
Indica II	465	26.20%	73.80%	0.00%	0.00%	NA
Indica III	913	36.70%	63.10%	0.22%	0.00%	NA
Indica Intermediate	786	27.50%	72.30%	0.25%	0.00%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	82.50%	17.50%	0.00%	0.00%	NA
Japonica Intermediate	241	86.70%	12.90%	0.00%	0.00%	T: 0.41%
VI/Aromatic	96	58.30%	40.60%	0.00%	0.00%	T: 1.04%
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125850665	G -> T	LOC_Os11g42900.1	upstream_gene_variant ; 3675.0bp to feature; MODIFIER	silent_mutation	Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1125850665	G -> T	LOC_Os11g42900-LOC_Os11g42910	intergenic_region ; MODIFIER	silent_mutation	Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1125850665	G -> A	LOC_Os11g42900.1	upstream_gene_variant ; 3675.0bp to feature; MODIFIER	silent_mutation	Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1125850665	G -> A	LOC_Os11g42900-LOC_Os11g42910	intergenic_region ; MODIFIER	silent_mutation	Average:28.952; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125850665	NA	4.91E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665	NA	7.02E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665	NA	1.05E-08	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665	NA	1.37E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665	NA	4.00E-06	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665	NA	1.18E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665	4.49E-07	3.91E-08	mr1925	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665	NA	6.06E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665	NA	1.84E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125850665	NA	1.14E-06	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251