Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125841143:

Variant ID: vg1125841143 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25841143
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, G: 0.34, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAACATAACACAAATTAATATAACCCACTAGTATTACTCCCATAATGCATAATGCCATGTGTCCAGCATGACAGCAAACAGATACTCCTACATATATA[G/T]
AGAGAGAGAGAGACAGAGAGAGGCCAGTCTCCTTTAAATTTGCAGTACTGCAAAACAAAACACTAGTGTGCAAGCTGCAGAGGTTGCAAGCTTAACATCT

Reverse complement sequence

AGATGTTAAGCTTGCAACCTCTGCAGCTTGCACACTAGTGTTTTGTTTTGCAGTACTGCAAATTTAAAGGAGACTGGCCTCTCTCTGTCTCTCTCTCTCT[C/A]
TATATATGTAGGAGTATCTGTTTGCTGTCATGCTGGACACATGGCATTATGCATTATGGGAGTAATACTAGTGGGTTATATTAATTTGTGTTATGTTCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	37.30%	0.32%	0.00%	NA
All Indica	2759	51.50%	48.10%	0.36%	0.00%	NA
All Japonica	1512	84.50%	15.30%	0.13%	0.00%	NA
Aus	269	43.50%	56.50%	0.00%	0.00%	NA
Indica I	595	48.70%	50.60%	0.67%	0.00%	NA
Indica II	465	66.90%	32.90%	0.22%	0.00%	NA
Indica III	913	42.70%	57.10%	0.22%	0.00%	NA
Indica Intermediate	786	54.80%	44.80%	0.38%	0.00%	NA
Temperate Japonica	767	83.30%	16.60%	0.13%	0.00%	NA
Tropical Japonica	504	84.50%	15.50%	0.00%	0.00%	NA
Japonica Intermediate	241	88.40%	11.20%	0.41%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	51.10%	45.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125841143	G -> T	LOC_Os11g42890.1	upstream_gene_variant ; 4445.0bp to feature; MODIFIER	silent_mutation	Average:46.546; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg1125841143	G -> T	LOC_Os11g42900.1	intron_variant ; MODIFIER	silent_mutation	Average:46.546; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125841143	5.89E-06	5.11E-14	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125841143	2.84E-06	1.22E-09	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125841143	NA	2.67E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125841143	2.51E-09	5.90E-20	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125841143	6.81E-08	5.00E-13	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125841143	2.63E-08	3.22E-21	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125841143	2.05E-06	7.95E-12	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125841143	1.88E-10	1.88E-10	mr1191_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251