Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125834367:

Variant ID: vg1125834367 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25834367
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGCGAGTTACATAAATATAGATAGAAACAAGATCTACTAACTCTTGCATCGACTACCAATCACAACTACAGAGTTCAGCATTCACAAACGAGATCAAT[G/A]
ATAATGCATATGTAGTTTTCAGCCCATGCTCATGCTGACACGAGTTGTAGCATGCAAAGACGCGTTGATTAATTGGTTCAGTCTAGGGATCGAGCCGATT

Reverse complement sequence

AATCGGCTCGATCCCTAGACTGAACCAATTAATCAACGCGTCTTTGCATGCTACAACTCGTGTCAGCATGAGCATGGGCTGAAAACTACATATGCATTAT[C/T]
ATTGATCTCGTTTGTGAATGCTGAACTCTGTAGTTGTGATTGGTAGTCGATGCAAGAGTTAGTAGATCTTGTTTCTATCTATATTTATGTAACTCGCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 26.70% 0.53% 3.51% NA
All Indica  2759 62.90% 30.60% 0.76% 5.76% NA
All Japonica  1512 80.40% 19.20% 0.20% 0.20% NA
Aus  269 76.60% 23.40% 0.00% 0.00% NA
Indica I  595 22.70% 75.80% 0.34% 1.18% NA
Indica II  465 79.10% 18.50% 0.00% 2.37% NA
Indica III  913 69.30% 17.00% 1.42% 12.27% NA
Indica Intermediate  786 76.20% 19.30% 0.76% 3.69% NA
Temperate Japonica  767 74.40% 25.00% 0.26% 0.26% NA
Tropical Japonica  504 93.80% 6.00% 0.20% 0.00% NA
Japonica Intermediate  241 71.00% 28.60% 0.00% 0.41% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 66.70% 27.80% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125834367 G -> A LOC_Os11g42890.1 3_prime_UTR_variant ; 160.0bp to feature; MODIFIER silent_mutation Average:53.196; most accessible tissue: Zhenshan97 flower, score: 72.578 N N N N
vg1125834367 G -> A LOC_Os11g42880.1 downstream_gene_variant ; 942.0bp to feature; MODIFIER silent_mutation Average:53.196; most accessible tissue: Zhenshan97 flower, score: 72.578 N N N N
vg1125834367 G -> DEL N N silent_mutation Average:53.196; most accessible tissue: Zhenshan97 flower, score: 72.578 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125834367 NA 6.96E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 5.65E-06 8.74E-07 mr1531 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 NA 1.47E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 NA 2.74E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 NA 3.94E-08 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 NA 3.53E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 NA 1.39E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 NA 2.13E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 NA 6.22E-06 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 NA 8.10E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125834367 NA 2.44E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251