Variant ID: vg1125834367 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 25834367 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
TTTGCGAGTTACATAAATATAGATAGAAACAAGATCTACTAACTCTTGCATCGACTACCAATCACAACTACAGAGTTCAGCATTCACAAACGAGATCAAT[G/A]
ATAATGCATATGTAGTTTTCAGCCCATGCTCATGCTGACACGAGTTGTAGCATGCAAAGACGCGTTGATTAATTGGTTCAGTCTAGGGATCGAGCCGATT
AATCGGCTCGATCCCTAGACTGAACCAATTAATCAACGCGTCTTTGCATGCTACAACTCGTGTCAGCATGAGCATGGGCTGAAAACTACATATGCATTAT[C/T]
ATTGATCTCGTTTGTGAATGCTGAACTCTGTAGTTGTGATTGGTAGTCGATGCAAGAGTTAGTAGATCTTGTTTCTATCTATATTTATGTAACTCGCAAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 69.30% | 26.70% | 0.53% | 3.51% | NA |
All Indica | 2759 | 62.90% | 30.60% | 0.76% | 5.76% | NA |
All Japonica | 1512 | 80.40% | 19.20% | 0.20% | 0.20% | NA |
Aus | 269 | 76.60% | 23.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 22.70% | 75.80% | 0.34% | 1.18% | NA |
Indica II | 465 | 79.10% | 18.50% | 0.00% | 2.37% | NA |
Indica III | 913 | 69.30% | 17.00% | 1.42% | 12.27% | NA |
Indica Intermediate | 786 | 76.20% | 19.30% | 0.76% | 3.69% | NA |
Temperate Japonica | 767 | 74.40% | 25.00% | 0.26% | 0.26% | NA |
Tropical Japonica | 504 | 93.80% | 6.00% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 71.00% | 28.60% | 0.00% | 0.41% | NA |
VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
Intermediate | 90 | 66.70% | 27.80% | 1.11% | 4.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1125834367 | G -> A | LOC_Os11g42890.1 | 3_prime_UTR_variant ; 160.0bp to feature; MODIFIER | silent_mutation | Average:53.196; most accessible tissue: Zhenshan97 flower, score: 72.578 | N | N | N | N |
vg1125834367 | G -> A | LOC_Os11g42880.1 | downstream_gene_variant ; 942.0bp to feature; MODIFIER | silent_mutation | Average:53.196; most accessible tissue: Zhenshan97 flower, score: 72.578 | N | N | N | N |
vg1125834367 | G -> DEL | N | N | silent_mutation | Average:53.196; most accessible tissue: Zhenshan97 flower, score: 72.578 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1125834367 | NA | 6.96E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | 5.65E-06 | 8.74E-07 | mr1531 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | NA | 1.47E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | NA | 2.74E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | NA | 3.94E-08 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | NA | 3.53E-06 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | NA | 1.39E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | NA | 2.13E-07 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | NA | 6.22E-06 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | NA | 8.10E-07 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125834367 | NA | 2.44E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |