Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125820968:

Variant ID: vg1125820968 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25820968
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

GCCGCCGCAGTCTGCCATCATCCTCATTGTCATGGCCGTGGCACTTGCGAGACCGGTAGCCTAGCAAGCGAGGAGAGGGCCTAACGGGGCACCGACCGCC[G/A]
GGCTTTTAGCATCGACAACCTCTCTCTCTTTCTCTACTATCACCATTGACTACTGGCTACCAGCCTCAACGACCTCTCTCTCTCTCTCTCCAACCTCACC

Reverse complement sequence

GGTGAGGTTGGAGAGAGAGAGAGAGAGGTCGTTGAGGCTGGTAGCCAGTAGTCAATGGTGATAGTAGAGAAAGAGAGAGAGGTTGTCGATGCTAAAAGCC[C/T]
GGCGGTCGGTGCCCCGTTAGGCCCTCTCCTCGCTTGCTAGGCTACCGGTCTCGCAAGTGCCACGGCCATGACAATGAGGATGATGGCAGACTGCGGCGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	26.50%	0.40%	0.00%	NA
All Indica	2759	61.20%	38.30%	0.43%	0.00%	NA
All Japonica	1512	97.00%	2.80%	0.13%	0.00%	NA
Aus	269	54.60%	45.40%	0.00%	0.00%	NA
Indica I	595	60.20%	39.00%	0.84%	0.00%	NA
Indica II	465	26.20%	73.30%	0.43%	0.00%	NA
Indica III	913	84.10%	15.70%	0.22%	0.00%	NA
Indica Intermediate	786	56.10%	43.50%	0.38%	0.00%	NA
Temperate Japonica	767	95.80%	4.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.00%	0.80%	0.20%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	84.40%	11.50%	4.17%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125820968	G -> A	LOC_Os11g42860.1	upstream_gene_variant ; 2950.0bp to feature; MODIFIER	silent_mutation	Average:48.491; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg1125820968	G -> A	LOC_Os11g42870.1	downstream_gene_variant ; 1827.0bp to feature; MODIFIER	silent_mutation	Average:48.491; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg1125820968	G -> A	LOC_Os11g42860-LOC_Os11g42870	intergenic_region ; MODIFIER	silent_mutation	Average:48.491; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125820968	NA	1.06E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968	7.39E-08	3.34E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968	7.17E-07	NA	mr1662	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968	NA	1.82E-06	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968	3.81E-08	8.58E-16	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968	3.00E-07	7.38E-06	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968	1.45E-07	1.08E-08	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968	1.36E-06	NA	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251