Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125820968:

Variant ID: vg1125820968 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25820968
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGCCGCAGTCTGCCATCATCCTCATTGTCATGGCCGTGGCACTTGCGAGACCGGTAGCCTAGCAAGCGAGGAGAGGGCCTAACGGGGCACCGACCGCC[G/A]
GGCTTTTAGCATCGACAACCTCTCTCTCTTTCTCTACTATCACCATTGACTACTGGCTACCAGCCTCAACGACCTCTCTCTCTCTCTCTCCAACCTCACC

Reverse complement sequence

GGTGAGGTTGGAGAGAGAGAGAGAGAGGTCGTTGAGGCTGGTAGCCAGTAGTCAATGGTGATAGTAGAGAAAGAGAGAGAGGTTGTCGATGCTAAAAGCC[C/T]
GGCGGTCGGTGCCCCGTTAGGCCCTCTCCTCGCTTGCTAGGCTACCGGTCTCGCAAGTGCCACGGCCATGACAATGAGGATGATGGCAGACTGCGGCGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.50% 0.40% 0.00% NA
All Indica  2759 61.20% 38.30% 0.43% 0.00% NA
All Japonica  1512 97.00% 2.80% 0.13% 0.00% NA
Aus  269 54.60% 45.40% 0.00% 0.00% NA
Indica I  595 60.20% 39.00% 0.84% 0.00% NA
Indica II  465 26.20% 73.30% 0.43% 0.00% NA
Indica III  913 84.10% 15.70% 0.22% 0.00% NA
Indica Intermediate  786 56.10% 43.50% 0.38% 0.00% NA
Temperate Japonica  767 95.80% 4.00% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 11.50% 4.17% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125820968 G -> A LOC_Os11g42860.1 upstream_gene_variant ; 2950.0bp to feature; MODIFIER silent_mutation Average:48.491; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1125820968 G -> A LOC_Os11g42870.1 downstream_gene_variant ; 1827.0bp to feature; MODIFIER silent_mutation Average:48.491; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1125820968 G -> A LOC_Os11g42860-LOC_Os11g42870 intergenic_region ; MODIFIER silent_mutation Average:48.491; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125820968 NA 1.06E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968 7.39E-08 3.34E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968 7.17E-07 NA mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968 NA 1.82E-06 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968 3.81E-08 8.58E-16 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968 3.00E-07 7.38E-06 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968 1.45E-07 1.08E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125820968 1.36E-06 NA mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251