\
| Variant ID: vg1125820968 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25820968 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 112. )
GCCGCCGCAGTCTGCCATCATCCTCATTGTCATGGCCGTGGCACTTGCGAGACCGGTAGCCTAGCAAGCGAGGAGAGGGCCTAACGGGGCACCGACCGCC[G/A]
GGCTTTTAGCATCGACAACCTCTCTCTCTTTCTCTACTATCACCATTGACTACTGGCTACCAGCCTCAACGACCTCTCTCTCTCTCTCTCCAACCTCACC
GGTGAGGTTGGAGAGAGAGAGAGAGAGGTCGTTGAGGCTGGTAGCCAGTAGTCAATGGTGATAGTAGAGAAAGAGAGAGAGGTTGTCGATGCTAAAAGCC[C/T]
GGCGGTCGGTGCCCCGTTAGGCCCTCTCCTCGCTTGCTAGGCTACCGGTCTCGCAAGTGCCACGGCCATGACAATGAGGATGATGGCAGACTGCGGCGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 26.50% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 61.20% | 38.30% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 97.00% | 2.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 54.60% | 45.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.20% | 39.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 26.20% | 73.30% | 0.43% | 0.00% | NA |
| Indica III | 913 | 84.10% | 15.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 56.10% | 43.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 95.80% | 4.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 11.50% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125820968 | G -> A | LOC_Os11g42860.1 | upstream_gene_variant ; 2950.0bp to feature; MODIFIER | silent_mutation | Average:48.491; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg1125820968 | G -> A | LOC_Os11g42870.1 | downstream_gene_variant ; 1827.0bp to feature; MODIFIER | silent_mutation | Average:48.491; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg1125820968 | G -> A | LOC_Os11g42860-LOC_Os11g42870 | intergenic_region ; MODIFIER | silent_mutation | Average:48.491; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125820968 | NA | 1.06E-09 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125820968 | 7.39E-08 | 3.34E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125820968 | 7.17E-07 | NA | mr1662 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125820968 | NA | 1.82E-06 | mr1051_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125820968 | 3.81E-08 | 8.58E-16 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125820968 | 3.00E-07 | 7.38E-06 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125820968 | 1.45E-07 | 1.08E-08 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125820968 | 1.36E-06 | NA | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |