\
| Variant ID: vg1125819922 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25819922 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 90. )
CCTTGGCTAGGGAGCAAATCGATGACCTCGTGCATCTCCATCAATCTCCTCACTAGCGTCGTCGAGCTCTGATTGGGGAGCAAATAAGCAACCTCACGGG[C/T]
GTCGTCGAGATGCTCCTCACCAACCTATCATAGTCTTAGGCATGCACGCACACTACAACAAAAACCTCATATAGAGGCACTTTTGTAGAGACGTTTTGCA
TGCAAAACGTCTCTACAAAAGTGCCTCTATATGAGGTTTTTGTTGTAGTGTGCGTGCATGCCTAAGACTATGATAGGTTGGTGAGGAGCATCTCGACGAC[G/A]
CCCGTGAGGTTGCTTATTTGCTCCCCAATCAGAGCTCGACGACGCTAGTGAGGAGATTGATGGAGATGCACGAGGTCATCGATTTGCTCCCTAGCCAAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 37.50% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 44.50% | 54.90% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 54.60% | 45.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 57.60% | 41.80% | 0.50% | 0.00% | NA |
| Indica II | 465 | 21.10% | 78.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 49.30% | 49.80% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 42.70% | 56.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 14.60% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 25.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125819922 | C -> T | LOC_Os11g42860.1 | upstream_gene_variant ; 1904.0bp to feature; MODIFIER | silent_mutation | Average:38.837; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1125819922 | C -> T | LOC_Os11g42870.1 | downstream_gene_variant ; 2873.0bp to feature; MODIFIER | silent_mutation | Average:38.837; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1125819922 | C -> T | LOC_Os11g42860-LOC_Os11g42870 | intergenic_region ; MODIFIER | silent_mutation | Average:38.837; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125819922 | 1.89E-07 | 2.49E-12 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125819922 | 1.33E-06 | 3.25E-11 | mr1609 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125819922 | 6.40E-08 | 6.22E-10 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125819922 | 2.11E-14 | 9.41E-19 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125819922 | 1.47E-11 | 5.53E-08 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125819922 | NA | 2.56E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |