\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125797847:

Variant ID: vg1125797847 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25797847
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTTAGCCGAAATTCTTGATTTCGACGAAACAATAATTATTAGATTAAACAAAATTCGGTCATGATATGGCCGATTAGATCGTTTCCCAGTGGAGTCAC[C/T]
AAAAATCGTGTTAGTAACTTTTTGTGACAAGTCGACAAGCACGATCGCAACACCTAAACACCTTGCGGTGATATGGAGTCACCAACCACCTCGATCTAGC

Reverse complement sequence

GCTAGATCGAGGTGGTTGGTGACTCCATATCACCGCAAGGTGTTTAGGTGTTGCGATCGTGCTTGTCGACTTGTCACAAAAAGTTACTAACACGATTTTT[G/A]
GTGACTCCACTGGGAAACGATCTAATCGGCCATATCATGACCGAATTTTGTTTAATCTAATAATTATTGTTTCGTCGAAATCAAGAATTTCGGCTAAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 19.40% 1.14% 33.01% NA
All Indica  2759 40.30% 10.60% 1.09% 48.06% NA
All Japonica  1512 54.80% 34.90% 1.39% 8.99% NA
Aus  269 48.00% 30.90% 0.00% 21.19% NA
Indica I  595 77.80% 3.00% 0.17% 18.99% NA
Indica II  465 30.30% 5.80% 1.94% 61.94% NA
Indica III  913 30.80% 11.80% 1.10% 56.30% NA
Indica Intermediate  786 28.80% 17.70% 1.27% 52.29% NA
Temperate Japonica  767 78.40% 16.20% 0.00% 5.48% NA
Tropical Japonica  504 24.00% 61.90% 0.99% 13.10% NA
Japonica Intermediate  241 44.00% 37.80% 6.64% 11.62% NA
VI/Aromatic  96 82.30% 0.00% 1.04% 16.67% NA
Intermediate  90 53.30% 16.70% 2.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125797847 C -> T LOC_Os11g42820.1 upstream_gene_variant ; 4734.0bp to feature; MODIFIER silent_mutation Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1125797847 C -> T LOC_Os11g42830.1 upstream_gene_variant ; 790.0bp to feature; MODIFIER silent_mutation Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1125797847 C -> T LOC_Os11g42840.1 upstream_gene_variant ; 1793.0bp to feature; MODIFIER silent_mutation Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1125797847 C -> T LOC_Os11g42830-LOC_Os11g42840 intergenic_region ; MODIFIER silent_mutation Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 N N N N
vg1125797847 C -> DEL N N silent_mutation Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125797847 NA 3.34E-09 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125797847 NA 1.01E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125797847 1.40E-06 2.39E-11 mr1133_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125797847 1.30E-06 1.79E-09 mr1667_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251