Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125797847:

Variant ID: vg1125797847 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25797847
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTTAGCCGAAATTCTTGATTTCGACGAAACAATAATTATTAGATTAAACAAAATTCGGTCATGATATGGCCGATTAGATCGTTTCCCAGTGGAGTCAC[C/T]
AAAAATCGTGTTAGTAACTTTTTGTGACAAGTCGACAAGCACGATCGCAACACCTAAACACCTTGCGGTGATATGGAGTCACCAACCACCTCGATCTAGC

Reverse complement sequence

GCTAGATCGAGGTGGTTGGTGACTCCATATCACCGCAAGGTGTTTAGGTGTTGCGATCGTGCTTGTCGACTTGTCACAAAAAGTTACTAACACGATTTTT[G/A]
GTGACTCCACTGGGAAACGATCTAATCGGCCATATCATGACCGAATTTTGTTTAATCTAATAATTATTGTTTCGTCGAAATCAAGAATTTCGGCTAAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.40%	19.40%	1.14%	33.01%	NA
All Indica	2759	40.30%	10.60%	1.09%	48.06%	NA
All Japonica	1512	54.80%	34.90%	1.39%	8.99%	NA
Aus	269	48.00%	30.90%	0.00%	21.19%	NA
Indica I	595	77.80%	3.00%	0.17%	18.99%	NA
Indica II	465	30.30%	5.80%	1.94%	61.94%	NA
Indica III	913	30.80%	11.80%	1.10%	56.30%	NA
Indica Intermediate	786	28.80%	17.70%	1.27%	52.29%	NA
Temperate Japonica	767	78.40%	16.20%	0.00%	5.48%	NA
Tropical Japonica	504	24.00%	61.90%	0.99%	13.10%	NA
Japonica Intermediate	241	44.00%	37.80%	6.64%	11.62%	NA
VI/Aromatic	96	82.30%	0.00%	1.04%	16.67%	NA
Intermediate	90	53.30%	16.70%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125797847	C -> T	LOC_Os11g42820.1	upstream_gene_variant ; 4734.0bp to feature; MODIFIER	silent_mutation	Average:50.511; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1125797847	C -> T	LOC_Os11g42830.1	upstream_gene_variant ; 790.0bp to feature; MODIFIER	silent_mutation	Average:50.511; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1125797847	C -> T	LOC_Os11g42840.1	upstream_gene_variant ; 1793.0bp to feature; MODIFIER	silent_mutation	Average:50.511; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1125797847	C -> T	LOC_Os11g42830-LOC_Os11g42840	intergenic_region ; MODIFIER	silent_mutation	Average:50.511; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg1125797847	C -> DEL	N	N	silent_mutation	Average:50.511; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125797847	NA	3.34E-09	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125797847	NA	1.01E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125797847	1.40E-06	2.39E-11	mr1133_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125797847	1.30E-06	1.79E-09	mr1667_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251