\
| Variant ID: vg1125797847 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25797847 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 96. )
TGTTTAGCCGAAATTCTTGATTTCGACGAAACAATAATTATTAGATTAAACAAAATTCGGTCATGATATGGCCGATTAGATCGTTTCCCAGTGGAGTCAC[C/T]
AAAAATCGTGTTAGTAACTTTTTGTGACAAGTCGACAAGCACGATCGCAACACCTAAACACCTTGCGGTGATATGGAGTCACCAACCACCTCGATCTAGC
GCTAGATCGAGGTGGTTGGTGACTCCATATCACCGCAAGGTGTTTAGGTGTTGCGATCGTGCTTGTCGACTTGTCACAAAAAGTTACTAACACGATTTTT[G/A]
GTGACTCCACTGGGAAACGATCTAATCGGCCATATCATGACCGAATTTTGTTTAATCTAATAATTATTGTTTCGTCGAAATCAAGAATTTCGGCTAAACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.40% | 19.40% | 1.14% | 33.01% | NA |
| All Indica | 2759 | 40.30% | 10.60% | 1.09% | 48.06% | NA |
| All Japonica | 1512 | 54.80% | 34.90% | 1.39% | 8.99% | NA |
| Aus | 269 | 48.00% | 30.90% | 0.00% | 21.19% | NA |
| Indica I | 595 | 77.80% | 3.00% | 0.17% | 18.99% | NA |
| Indica II | 465 | 30.30% | 5.80% | 1.94% | 61.94% | NA |
| Indica III | 913 | 30.80% | 11.80% | 1.10% | 56.30% | NA |
| Indica Intermediate | 786 | 28.80% | 17.70% | 1.27% | 52.29% | NA |
| Temperate Japonica | 767 | 78.40% | 16.20% | 0.00% | 5.48% | NA |
| Tropical Japonica | 504 | 24.00% | 61.90% | 0.99% | 13.10% | NA |
| Japonica Intermediate | 241 | 44.00% | 37.80% | 6.64% | 11.62% | NA |
| VI/Aromatic | 96 | 82.30% | 0.00% | 1.04% | 16.67% | NA |
| Intermediate | 90 | 53.30% | 16.70% | 2.22% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125797847 | C -> T | LOC_Os11g42820.1 | upstream_gene_variant ; 4734.0bp to feature; MODIFIER | silent_mutation | Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1125797847 | C -> T | LOC_Os11g42830.1 | upstream_gene_variant ; 790.0bp to feature; MODIFIER | silent_mutation | Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1125797847 | C -> T | LOC_Os11g42840.1 | upstream_gene_variant ; 1793.0bp to feature; MODIFIER | silent_mutation | Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1125797847 | C -> T | LOC_Os11g42830-LOC_Os11g42840 | intergenic_region ; MODIFIER | silent_mutation | Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg1125797847 | C -> DEL | N | N | silent_mutation | Average:50.511; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125797847 | NA | 3.34E-09 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125797847 | NA | 1.01E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125797847 | 1.40E-06 | 2.39E-11 | mr1133_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125797847 | 1.30E-06 | 1.79E-09 | mr1667_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |