\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125786354:

Variant ID: vg1125786354 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25786354
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CTACGTCAAACTTCTTTTAACTTTTTAAGTTTATTATAGAAAAATGGTAGCAATATTTTCAGCACAAAACAAATACAATATCAAAATATATTCAATGCTA[G/A]
ATTAAACTAATTTGATATTGTAGATGTTGCTATGTTTTTATATTAACATTGTCAAACTTATCAATGTTTGGATTTAGAAAAAATAATGTCTTATAATGTG

Reverse complement sequence

CACATTATAAGACATTATTTTTTCTAAATCCAAACATTGATAAGTTTGACAATGTTAATATAAAAACATAGCAACATCTACAATATCAAATTAGTTTAAT[C/T]
TAGCATTGAATATATTTTGATATTGTATTTGTTTTGTGCTGAAAATATTGCTACCATTTTTCTATAATAAACTTAAAAAGTTAAAAGAAGTTTGACGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 14.70% 1.69% 14.11% NA
All Indica  2759 54.20% 22.40% 2.54% 20.84% NA
All Japonica  1512 96.10% 2.20% 0.46% 1.19% NA
Aus  269 84.80% 0.70% 0.00% 14.50% NA
Indica I  595 62.90% 28.60% 1.01% 7.56% NA
Indica II  465 26.00% 19.80% 5.59% 48.60% NA
Indica III  913 56.40% 24.60% 1.86% 17.09% NA
Indica Intermediate  786 61.80% 16.70% 2.67% 18.83% NA
Temperate Japonica  767 98.00% 0.70% 0.13% 1.17% NA
Tropical Japonica  504 92.10% 5.60% 0.99% 1.39% NA
Japonica Intermediate  241 98.30% 0.40% 0.41% 0.83% NA
VI/Aromatic  96 46.90% 25.00% 3.12% 25.00% NA
Intermediate  90 70.00% 17.80% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125786354 G -> A LOC_Os11g42810.1 intron_variant ; MODIFIER silent_mutation Average:31.267; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1125786354 G -> DEL N N silent_mutation Average:31.267; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125786354 7.95E-18 6.42E-30 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 1.06E-17 5.93E-24 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 NA 2.52E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 3.34E-06 3.20E-10 mr1561 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 NA 5.85E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 3.12E-21 1.42E-35 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 4.24E-20 2.10E-27 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 NA 7.78E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 NA 4.19E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 NA 2.87E-07 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 1.56E-19 9.75E-41 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 3.81E-20 1.68E-34 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 1.11E-06 4.17E-12 mr1380_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 8.70E-06 1.39E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 5.55E-07 2.00E-13 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 4.84E-06 1.08E-08 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 NA 6.50E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 NA 8.37E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 2.01E-06 5.10E-12 mr1875_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 3.06E-06 9.62E-08 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 5.35E-07 3.38E-13 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 2.31E-06 2.84E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 1.73E-06 6.60E-09 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786354 NA 1.78E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251