Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125773021:

Variant ID: vg1125773021 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25773021
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGATGGGACTAAAACTTTTAAGTCCCTATCACATCGGATGTTTGAATATTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCCTG[G/C]
ACTAATTCGTGAGACGAATCTATTGAGCCTAACTAATCCATGATTAGCCTATGTGATGCTACAGTAAACATTCTCTAATTATGGATTAATTAGGCTTAAA

Reverse complement sequence

TTTAAGCCTAATTAATCCATAATTAGAGAATGTTTACTGTAGCATCACATAGGCTAATCATGGATTAGTTAGGCTCAATAGATTCGTCTCACGAATTAGT[C/G]
CAGGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATATTCAAACATCCGATGTGATAGGGACTTAAAAGTTTTAGTCCCATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 1.40% 18.18% 32.29% NA
All Indica  2759 44.90% 2.20% 25.92% 27.00% NA
All Japonica  1512 52.40% 0.10% 3.97% 43.52% NA
Aus  269 55.80% 0.00% 11.15% 33.09% NA
Indica I  595 61.50% 1.30% 25.04% 12.10% NA
Indica II  465 21.70% 5.60% 54.84% 17.85% NA
Indica III  913 48.40% 1.10% 13.14% 37.35% NA
Indica Intermediate  786 41.90% 2.20% 24.30% 31.68% NA
Temperate Japonica  767 76.80% 0.00% 3.65% 19.56% NA
Tropical Japonica  504 18.70% 0.20% 3.37% 77.78% NA
Japonica Intermediate  241 45.60% 0.00% 6.22% 48.13% NA
VI/Aromatic  96 64.60% 0.00% 33.33% 2.08% NA
Intermediate  90 37.80% 2.20% 24.44% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125773021 G -> DEL N N silent_mutation Average:63.116; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg1125773021 G -> C LOC_Os11g42790.1 upstream_gene_variant ; 452.0bp to feature; MODIFIER silent_mutation Average:63.116; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg1125773021 G -> C LOC_Os11g42800.1 downstream_gene_variant ; 2787.0bp to feature; MODIFIER silent_mutation Average:63.116; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg1125773021 G -> C LOC_Os11g42790-LOC_Os11g42800 intergenic_region ; MODIFIER silent_mutation Average:63.116; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125773021 G C 0.0 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125773021 NA 5.33E-06 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 NA 7.83E-07 mr1236_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 NA 5.38E-08 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 NA 6.84E-06 mr1345_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 NA 7.18E-06 mr1396_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 4.93E-06 4.93E-06 mr1516_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 NA 8.03E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 NA 7.40E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 7.60E-06 7.60E-06 mr1777_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 NA 4.03E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 4.54E-06 4.54E-06 mr1939_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125773021 NA 5.93E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251