Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125768179:

Variant ID: vg1125768179 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25768179
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCTCCCTCTTCTTTGTTCTGTGACATATAAATAGTTAAAAATAAATCTATTTTAGATCCCTATTCTTTGGACTGTGATATTAATATGTCTATTTTTA[G/A]
TCCTTATACTTTGTTTGCCGAGCCTGGCCTGCCGGCCCATCGTGTCGGGCCAGCCCAGCGTGCCAGTGGGGAGGCCCAAGCATGGCCCAGCGGTCGAGCC

Reverse complement sequence

GGCTCGACCGCTGGGCCATGCTTGGGCCTCCCCACTGGCACGCTGGGCTGGCCCGACACGATGGGCCGGCAGGCCAGGCTCGGCAAACAAAGTATAAGGA[C/T]
TAAAAATAGACATATTAATATCACAGTCCAAAGAATAGGGATCTAAAATAGATTTATTTTTAACTATTTATATGTCACAGAACAAAGAAGAGGGAGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 18.40% 1.10% 40.56% NA
All Indica  2759 35.50% 6.20% 1.30% 56.98% NA
All Japonica  1512 47.00% 41.90% 0.33% 10.85% NA
Aus  269 44.20% 1.90% 2.97% 50.93% NA
Indica I  595 77.50% 0.80% 0.34% 21.34% NA
Indica II  465 23.70% 5.80% 1.72% 68.82% NA
Indica III  913 26.00% 8.80% 1.10% 64.18% NA
Indica Intermediate  786 21.90% 7.50% 2.04% 68.58% NA
Temperate Japonica  767 67.30% 19.00% 0.39% 13.30% NA
Tropical Japonica  504 18.30% 73.20% 0.20% 8.33% NA
Japonica Intermediate  241 42.30% 49.00% 0.41% 8.30% NA
VI/Aromatic  96 41.70% 42.70% 1.04% 14.58% NA
Intermediate  90 41.10% 23.30% 2.22% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125768179 G -> A LOC_Os11g42770.1 downstream_gene_variant ; 4964.0bp to feature; MODIFIER silent_mutation Average:77.863; most accessible tissue: Zhenshan97 panicle, score: 99.976 N N N N
vg1125768179 G -> A LOC_Os11g42780.1 downstream_gene_variant ; 1084.0bp to feature; MODIFIER silent_mutation Average:77.863; most accessible tissue: Zhenshan97 panicle, score: 99.976 N N N N
vg1125768179 G -> A LOC_Os11g42790.1 downstream_gene_variant ; 286.0bp to feature; MODIFIER silent_mutation Average:77.863; most accessible tissue: Zhenshan97 panicle, score: 99.976 N N N N
vg1125768179 G -> A LOC_Os11g42780-LOC_Os11g42790 intergenic_region ; MODIFIER silent_mutation Average:77.863; most accessible tissue: Zhenshan97 panicle, score: 99.976 N N N N
vg1125768179 G -> DEL N N silent_mutation Average:77.863; most accessible tissue: Zhenshan97 panicle, score: 99.976 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125768179 G A -0.03 -0.03 -0.01 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125768179 NA 2.15E-13 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125768179 NA 9.15E-08 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 NA 5.46E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 NA 1.97E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 NA 4.77E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 NA 5.70E-09 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 NA 8.59E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 1.38E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 5.13E-06 2.56E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 5.01E-06 NA mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 NA 3.11E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 2.00E-07 NA mr1609_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 NA 5.47E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 7.77E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 NA 2.11E-06 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 NA 6.38E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125768179 1.75E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251