\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125740602:

Variant ID: vg1125740602 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25740602
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGAGGGGAGCCTCGGTATTCGTGTTCAATAATCAAAGAAGGTAAATGCAGCAATTGGGTAAGGCCTGCCAGCTATATTGCAAACCGAGGCCAAGTGTC[C/A]
AGTGTACTCCTAGGAAGGCATAGTTGCAGAATCAAAATACTTAATTTCAAAATTATAGGTTCAATTGATCAAAGGTGACTTGCCTTGCTCGAGATCTTGA

Reverse complement sequence

TCAAGATCTCGAGCAAGGCAAGTCACCTTTGATCAATTGAACCTATAATTTTGAAATTAAGTATTTTGATTCTGCAACTATGCCTTCCTAGGAGTACACT[G/T]
GACACTTGGCCTCGGTTTGCAATATAGCTGGCAGGCCTTACCCAATTGCTGCATTTACCTTCTTTGATTATTGAACACGAATACCGAGGCTCCCCTCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.70% 0.30% 7.47% 59.52% NA
All Indica  2759 30.50% 0.40% 10.44% 58.68% NA
All Japonica  1512 39.00% 0.10% 1.59% 59.39% NA
Aus  269 28.30% 0.70% 9.67% 61.34% NA
Indica I  595 58.80% 0.00% 5.04% 36.13% NA
Indica II  465 36.10% 0.00% 11.61% 52.26% NA
Indica III  913 13.70% 1.00% 11.17% 74.15% NA
Indica Intermediate  786 25.20% 0.30% 12.98% 61.58% NA
Temperate Japonica  767 60.90% 0.00% 1.56% 37.55% NA
Tropical Japonica  504 12.30% 0.20% 2.38% 85.12% NA
Japonica Intermediate  241 24.90% 0.00% 0.00% 75.10% NA
VI/Aromatic  96 8.30% 0.00% 8.33% 83.33% NA
Intermediate  90 35.60% 0.00% 7.78% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125740602 C -> A LOC_Os11g42740.1 upstream_gene_variant ; 917.0bp to feature; MODIFIER silent_mutation Average:11.724; most accessible tissue: Callus, score: 42.069 N N N N
vg1125740602 C -> A LOC_Os11g42720.1 downstream_gene_variant ; 3599.0bp to feature; MODIFIER silent_mutation Average:11.724; most accessible tissue: Callus, score: 42.069 N N N N
vg1125740602 C -> A LOC_Os11g42730.1 downstream_gene_variant ; 2446.0bp to feature; MODIFIER silent_mutation Average:11.724; most accessible tissue: Callus, score: 42.069 N N N N
vg1125740602 C -> A LOC_Os11g42730-LOC_Os11g42740 intergenic_region ; MODIFIER silent_mutation Average:11.724; most accessible tissue: Callus, score: 42.069 N N N N
vg1125740602 C -> DEL N N silent_mutation Average:11.724; most accessible tissue: Callus, score: 42.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125740602 3.24E-06 NA Grain_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125740602 NA 9.94E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602 NA 9.55E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602 NA 1.17E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602 NA 1.45E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602 NA 2.03E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602 NA 4.41E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251