\
| Variant ID: vg1125740602 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25740602 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTGAGGGGAGCCTCGGTATTCGTGTTCAATAATCAAAGAAGGTAAATGCAGCAATTGGGTAAGGCCTGCCAGCTATATTGCAAACCGAGGCCAAGTGTC[C/A]
AGTGTACTCCTAGGAAGGCATAGTTGCAGAATCAAAATACTTAATTTCAAAATTATAGGTTCAATTGATCAAAGGTGACTTGCCTTGCTCGAGATCTTGA
TCAAGATCTCGAGCAAGGCAAGTCACCTTTGATCAATTGAACCTATAATTTTGAAATTAAGTATTTTGATTCTGCAACTATGCCTTCCTAGGAGTACACT[G/T]
GACACTTGGCCTCGGTTTGCAATATAGCTGGCAGGCCTTACCCAATTGCTGCATTTACCTTCTTTGATTATTGAACACGAATACCGAGGCTCCCCTCAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 0.30% | 7.47% | 59.52% | NA |
| All Indica | 2759 | 30.50% | 0.40% | 10.44% | 58.68% | NA |
| All Japonica | 1512 | 39.00% | 0.10% | 1.59% | 59.39% | NA |
| Aus | 269 | 28.30% | 0.70% | 9.67% | 61.34% | NA |
| Indica I | 595 | 58.80% | 0.00% | 5.04% | 36.13% | NA |
| Indica II | 465 | 36.10% | 0.00% | 11.61% | 52.26% | NA |
| Indica III | 913 | 13.70% | 1.00% | 11.17% | 74.15% | NA |
| Indica Intermediate | 786 | 25.20% | 0.30% | 12.98% | 61.58% | NA |
| Temperate Japonica | 767 | 60.90% | 0.00% | 1.56% | 37.55% | NA |
| Tropical Japonica | 504 | 12.30% | 0.20% | 2.38% | 85.12% | NA |
| Japonica Intermediate | 241 | 24.90% | 0.00% | 0.00% | 75.10% | NA |
| VI/Aromatic | 96 | 8.30% | 0.00% | 8.33% | 83.33% | NA |
| Intermediate | 90 | 35.60% | 0.00% | 7.78% | 56.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125740602 | C -> A | LOC_Os11g42740.1 | upstream_gene_variant ; 917.0bp to feature; MODIFIER | silent_mutation | Average:11.724; most accessible tissue: Callus, score: 42.069 | N | N | N | N |
| vg1125740602 | C -> A | LOC_Os11g42720.1 | downstream_gene_variant ; 3599.0bp to feature; MODIFIER | silent_mutation | Average:11.724; most accessible tissue: Callus, score: 42.069 | N | N | N | N |
| vg1125740602 | C -> A | LOC_Os11g42730.1 | downstream_gene_variant ; 2446.0bp to feature; MODIFIER | silent_mutation | Average:11.724; most accessible tissue: Callus, score: 42.069 | N | N | N | N |
| vg1125740602 | C -> A | LOC_Os11g42730-LOC_Os11g42740 | intergenic_region ; MODIFIER | silent_mutation | Average:11.724; most accessible tissue: Callus, score: 42.069 | N | N | N | N |
| vg1125740602 | C -> DEL | N | N | silent_mutation | Average:11.724; most accessible tissue: Callus, score: 42.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125740602 | 3.24E-06 | NA | Grain_length | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1125740602 | NA | 9.94E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125740602 | NA | 9.55E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125740602 | NA | 1.17E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125740602 | NA | 1.45E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125740602 | NA | 2.03E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125740602 | NA | 4.41E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |