\
| Variant ID: vg1125735290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25735290 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 136. )
AGCTCCCTGAAACATCTCAAATGTCAATGCTTAAGGTGTTAGATCTAGAAGGTTGTCAATGCTTCCAGAGGAACCAGCACTACCTCAAGGACATTTGCAA[C/T]
AATATTTTACTGCTCAAGTATTTGAGCCTAAGGAGAACAGATGTTACACAGCTACCTAGTGAAATCAACAACCTCTATGAGCTGGAGGTACTGGATATTT
AAATATCCAGTACCTCCAGCTCATAGAGGTTGTTGATTTCACTAGGTAGCTGTGTAACATCTGTTCTCCTTAGGCTCAAATACTTGAGCAGTAAAATATT[G/A]
TTGCAAATGTCCTTGAGGTAGTGCTGGTTCCTCTGGAAGCATTGACAACCTTCTAGATCTAACACCTTAAGCATTGACATTTGAGATGTTTCAGGGAGCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 28.70% | 4.06% | 13.22% | NA |
| All Indica | 2759 | 49.00% | 29.90% | 5.55% | 15.59% | NA |
| All Japonica | 1512 | 61.60% | 27.30% | 1.39% | 9.66% | NA |
| Aus | 269 | 46.80% | 33.80% | 5.20% | 14.13% | NA |
| Indica I | 595 | 38.50% | 44.70% | 4.87% | 11.93% | NA |
| Indica II | 465 | 56.60% | 34.20% | 3.01% | 6.24% | NA |
| Indica III | 913 | 53.60% | 20.60% | 4.82% | 21.03% | NA |
| Indica Intermediate | 786 | 47.10% | 27.00% | 8.40% | 17.56% | NA |
| Temperate Japonica | 767 | 40.00% | 44.70% | 1.96% | 13.30% | NA |
| Tropical Japonica | 504 | 88.50% | 6.00% | 0.99% | 4.56% | NA |
| Japonica Intermediate | 241 | 74.30% | 16.60% | 0.41% | 8.71% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 56.70% | 31.10% | 3.33% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125735290 | C -> T | LOC_Os11g42720.1 | synonymous_variant ; p.Asn825Asn; LOW | synonymous_codon | Average:18.636; most accessible tissue: Callus, score: 49.019 | N | N | N | N |
| vg1125735290 | C -> DEL | LOC_Os11g42720.1 | N | frameshift_variant | Average:18.636; most accessible tissue: Callus, score: 49.019 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125735290 | NA | 2.04E-08 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125735290 | 5.04E-06 | 3.65E-07 | mr1569 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125735290 | NA | 1.23E-08 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125735290 | 2.49E-06 | 2.37E-12 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125735290 | NA | 1.86E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125735290 | 9.49E-07 | 2.42E-16 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125735290 | NA | 4.00E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125735290 | NA | 2.13E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125735290 | 5.65E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125735290 | NA | 2.03E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |