Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125675581:

Variant ID: vg1125675581 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25675581
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAATGCAAAAAATCAACTCTTACCGAGACAGTCGGAGAGGGTGGTGGAGAAGGAGAAGGGGTCCTCAATCGTGCCTTGGCTCGTTCGCGCCGTTGCAA[A/G]
GTTGTTTTCTTGGTTCTTGGCAAAGGGACCGATTGAGTTCTCTCCTTCAACGCAGACGACACCGCAGCCTAAAAAGGATATGAAGTTAAAGTGTGACAGT

Reverse complement sequence

ACTGTCACACTTTAACTTCATATCCTTTTTAGGCTGCGGTGTCGTCTGCGTTGAAGGAGAGAACTCAATCGGTCCCTTTGCCAAGAACCAAGAAAACAAC[T/C]
TTGCAACGGCGCGAACGAGCCAAGGCACGATTGAGGACCCCTTCTCCTTCTCCACCACCCTCTCCGACTGTCTCGGTAAGAGTTGATTTTTTGCATTATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.80% 4.40% 3.24% 19.53% NA
All Indica  2759 68.80% 4.30% 3.52% 23.45% NA
All Japonica  1512 82.30% 2.60% 2.58% 12.50% NA
Aus  269 55.80% 16.00% 4.09% 24.16% NA
Indica I  595 76.30% 6.10% 0.67% 16.97% NA
Indica II  465 69.70% 0.40% 1.72% 28.17% NA
Indica III  913 62.70% 4.70% 6.46% 26.18% NA
Indica Intermediate  786 69.60% 4.70% 3.31% 22.39% NA
Temperate Japonica  767 91.30% 1.80% 1.30% 5.61% NA
Tropical Japonica  504 72.00% 1.80% 3.77% 22.42% NA
Japonica Intermediate  241 75.50% 6.60% 4.15% 13.69% NA
VI/Aromatic  96 83.30% 3.10% 3.12% 10.42% NA
Intermediate  90 76.70% 6.70% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125675581 A -> DEL LOC_Os11g42640.1 N frameshift_variant Average:47.094; most accessible tissue: Minghui63 flag leaf, score: 90.909 N N N N
vg1125675581 A -> G LOC_Os11g42640.1 synonymous_variant ; p.Thr662Thr; LOW synonymous_codon Average:47.094; most accessible tissue: Minghui63 flag leaf, score: 90.909 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125675581 A G 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125675581 NA 5.55E-06 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125675581 NA 1.62E-06 mr1585_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251