\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125669886:

Variant ID: vg1125669886 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25669886
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATCCGTGCATGAAAGGCTGGGGCCGATGCACCAAGATCAACACGATGAAGATGAGGAACAAGTCCAGAACCCCCAATGGTGCCCAAGCGATGTATTCA[G/C,A]
CAAGACACAGAAGCGGCGGGTTCAGAGGTTAAGGAGGAAAGAGCAAATCCAAGAGCAACAAGCTGAAATACCCCATCGGCCCACCAAGACCAAAAAAGAG

Reverse complement sequence

CTCTTTTTTGGTCTTGGTGGGCCGATGGGGTATTTCAGCTTGTTGCTCTTGGATTTGCTCTTTCCTCCTTAACCTCTGAACCCGCCGCTTCTGTGTCTTG[C/G,T]
TGAATACATCGCTTGGGCACCATTGGGGGTTCTGGACTTGTTCCTCATCTTCATCGTGTTGATCTTGGTGCATCGGCCCCAGCCTTTCATGCACGGATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 22.30% 16.08% 27.04% NA
All Indica  2759 28.60% 27.40% 14.90% 29.07% NA
All Japonica  1512 45.80% 11.20% 18.85% 24.14% NA
Aus  269 43.10% 24.90% 11.52% 20.45% NA
Indica I  595 35.00% 34.50% 18.15% 12.44% NA
Indica II  465 26.90% 28.40% 18.71% 26.02% NA
Indica III  913 23.30% 23.50% 10.62% 42.50% NA
Indica Intermediate  786 31.00% 26.00% 15.14% 27.86% NA
Temperate Japonica  767 63.50% 5.50% 19.30% 11.73% NA
Tropical Japonica  504 19.60% 16.90% 19.44% 44.05% NA
Japonica Intermediate  241 44.00% 17.80% 16.18% 21.99% NA
VI/Aromatic  96 17.70% 36.50% 16.67% 29.17% NA
Intermediate  90 22.20% 27.80% 18.89% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125669886 G -> A LOC_Os11g42630.1 missense_variant ; p.Ser754Asn; MODERATE N Average:68.736; most accessible tissue: Minghui63 flag leaf, score: 95.521 N N N N
vg1125669886 G -> A LOC_Os11g42640.1 downstream_gene_variant ; 4734.0bp to feature; MODIFIER N Average:68.736; most accessible tissue: Minghui63 flag leaf, score: 95.521 N N N N
vg1125669886 G -> DEL LOC_Os11g42630.1 N frameshift_variant Average:68.736; most accessible tissue: Minghui63 flag leaf, score: 95.521 N N N N
vg1125669886 G -> C LOC_Os11g42630.1 missense_variant ; p.Ser754Thr; MODERATE nonsynonymous_codon ; S754T Average:68.736; most accessible tissue: Minghui63 flag leaf, score: 95.521 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125669886 G A -0.02 -0.02 -0.02 -0.02 -0.02 -0.02
vg1125669886 G C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125669886 1.66E-06 1.14E-15 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 1.21E-09 1.21E-16 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 6.01E-10 1.62E-19 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 6.37E-12 7.67E-19 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 NA 8.93E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 2.66E-06 NA mr1041_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 1.98E-06 3.04E-24 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 2.16E-09 3.25E-24 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 5.70E-06 5.69E-06 mr1412_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 1.65E-06 1.98E-07 mr1494_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 2.73E-06 NA mr1604_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 NA 7.51E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 NA 8.55E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 NA 3.00E-06 mr1759_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 2.56E-06 NA mr1800_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 4.01E-06 2.85E-07 mr1814_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 8.90E-06 2.81E-06 mr1823_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 NA 1.98E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 NA 1.32E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 NA 2.73E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125669886 9.38E-07 5.76E-07 mr1894_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251