Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125658815:

Variant ID: vg1125658815 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 25658815
Reference Allele: A	Alternative Allele: G,T,ATG
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCTGGGGTCTACTTCAACACCTTTGGTGGAGATGACATGGCCAAGGAAGGCTACTTTATCCAACCAAAACTCACACTTTGAGTACTTGGCAAAGAGTC[A/G,T,ATG]
GTGTTCACGCAACCTTTCCATTACCTTCCGTAGATGATTTGCATGATCTTGTTCATTCCCGGAGTAAATCAGAATGTCGTCGATGAAGACCACTACGAAC

Reverse complement sequence

GTTCGTAGTGGTCTTCATCGACGACATTCTGATTTACTCCGGGAATGAACAAGATCATGCAAATCATCTACGGAAGGTAATGGAAAGGTTGCGTGAACAC[T/C,A,CAT]
GACTCTTTGCCAAGTACTCAAAGTGTGAGTTTTGGTTGGATAAAGTAGCCTTCCTTGGCCATGTCATCTCCACCAAAGGTGTTGAAGTAGACCCCAGGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.10%	28.40%	5.56%	27.76%	T: 0.13%
All Indica	2759	54.00%	23.10%	3.33%	19.43%	T: 0.11%
All Japonica	1512	8.60%	39.30%	9.13%	42.99%	NA
Aus	269	49.80%	26.80%	5.95%	17.47%	NA
Indica I	595	28.90%	49.60%	1.18%	20.34%	NA
Indica II	465	74.00%	19.80%	0.43%	5.59%	T: 0.22%
Indica III	913	61.20%	8.70%	3.29%	26.73%	T: 0.11%
Indica Intermediate	786	52.80%	21.90%	6.74%	18.45%	T: 0.13%
Temperate Japonica	767	5.70%	61.40%	2.87%	29.99%	NA
Tropical Japonica	504	10.50%	12.50%	16.47%	60.52%	NA
Japonica Intermediate	241	13.70%	24.90%	13.69%	47.72%	NA
VI/Aromatic	96	20.80%	8.30%	12.50%	55.21%	T: 3.12%
Intermediate	90	31.10%	34.40%	5.56%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125658815	A -> ATG	LOC_Os11g42620.1	intron_variant ; MODIFIER	N	Average:32.628; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1125658815	A -> T	LOC_Os11g42620.1	intron_variant ; MODIFIER	silent_mutation	Average:32.628; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1125658815	A -> DEL	N	N	silent_mutation	Average:32.628; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg1125658815	A -> G	LOC_Os11g42620.1	intron_variant ; MODIFIER	silent_mutation	Average:32.628; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125658815	NA	6.42E-07	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	NA	9.41E-08	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	NA	1.01E-06	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	NA	2.72E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	NA	1.16E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	NA	5.07E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	NA	3.15E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	NA	2.80E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	NA	5.54E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	NA	4.52E-06	mr1894_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125658815	2.05E-06	2.06E-06	mr1983_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251