\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125651425:

Variant ID: vg1125651425 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25651425
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCATCATTGTTGTCTCTGTAAGCAACTGGTGAGCATGTGTAACTAAAATTTTGATATGAGTACAAGTTTAGAGCATTTGAGATATTGTAGAGCTCAAGC[G/A]
AATTTTTGTCAAGTCTCCTGAGATGTGTAACACATCTGGTCGCCGCCTTCGTGTGGTTTGACGGGCATGTCTTAGGCTGAAGTTGACTGGCACGCTGAGT

Reverse complement sequence

ACTCAGCGTGCCAGTCAACTTCAGCCTAAGACATGCCCGTCAAACCACACGAAGGCGGCGACCAGATGTGTTACACATCTCAGGAGACTTGACAAAAATT[C/T]
GCTTGAGCTCTACAATATCTCAAATGCTCTAAACTTGTACTCATATCAAAATTTTAGTTACACATGCTCACCAGTTGCTTACAGAGACAACAATGATGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 2.90% 7.45% 3.64% NA
All Indica  2759 87.50% 2.80% 6.96% 2.79% NA
All Japonica  1512 83.90% 2.20% 8.47% 5.36% NA
Aus  269 84.80% 6.30% 7.43% 1.49% NA
Indica I  595 94.30% 0.20% 4.20% 1.34% NA
Indica II  465 73.10% 7.50% 14.84% 4.52% NA
Indica III  913 93.60% 0.70% 3.83% 1.86% NA
Indica Intermediate  786 83.60% 4.50% 8.02% 3.94% NA
Temperate Japonica  767 79.70% 4.00% 10.56% 5.74% NA
Tropical Japonica  504 88.50% 0.00% 6.94% 4.56% NA
Japonica Intermediate  241 88.00% 1.20% 4.98% 5.81% NA
VI/Aromatic  96 82.30% 8.30% 5.21% 4.17% NA
Intermediate  90 82.20% 3.30% 7.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125651425 G -> A LOC_Os11g42610.1 downstream_gene_variant ; 337.0bp to feature; MODIFIER silent_mutation Average:52.833; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg1125651425 G -> A LOC_Os11g42610-LOC_Os11g42620 intergenic_region ; MODIFIER silent_mutation Average:52.833; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg1125651425 G -> DEL N N silent_mutation Average:52.833; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125651425 G A -0.07 -0.03 -0.02 -0.03 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125651425 NA 9.34E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125651425 NA 7.90E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125651425 4.88E-07 4.88E-07 mr1663 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125651425 NA 6.89E-10 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125651425 NA 1.42E-11 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125651425 NA 1.75E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125651425 NA 2.91E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251