\
| Variant ID: vg1125628490 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25628490 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, G: 0.21, others allele: 0.00, population size: 213. )
GCCTTCACAAGTGCCGGAAGCAGGCAAATCTTTGGTGAAGGCCGAGCAAGCCACACCTAATCCAGCCAATCAGGATGACCATGAATTTACAAGTGCTATC[C/G]
AAGAAACCAAGGAAAAGATCGCACAAATCGGGGTAAAGATCGAGGAACGGCTTCTTATCGAATGCATAGTTGAGGAGATTAAAGAGCTTTTGGGAGGTAA
TTACCTCCCAAAAGCTCTTTAATCTCCTCAACTATGCATTCGATAAGAAGCCGTTCCTCGATCTTTACCCCGATTTGTGCGATCTTTTCCTTGGTTTCTT[G/C]
GATAGCACTTGTAAATTCATGGTCATCCTGATTGGCTGGATTAGGTGTGGCTTGCTCGGCCTTCACCAAAGATTTGCCTGCTTCCGGCACTTGTGAAGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 30.90% | 0.74% | 7.26% | NA |
| All Indica | 2759 | 66.60% | 22.40% | 1.05% | 9.97% | NA |
| All Japonica | 1512 | 48.90% | 46.60% | 0.33% | 4.17% | NA |
| Aus | 269 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.60% | 5.50% | 0.34% | 0.50% | NA |
| Indica II | 465 | 35.70% | 58.70% | 0.43% | 5.16% | NA |
| Indica III | 913 | 63.60% | 15.10% | 1.10% | 20.15% | NA |
| Indica Intermediate | 786 | 67.80% | 22.10% | 1.91% | 8.14% | NA |
| Temperate Japonica | 767 | 74.70% | 25.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 11.50% | 76.00% | 0.60% | 11.90% | NA |
| Japonica Intermediate | 241 | 45.20% | 53.10% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 34.40% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125628490 | C -> DEL | LOC_Os11g42580.1 | N | frameshift_variant | Average:58.834; most accessible tissue: Zhenshan97 flower, score: 73.141 | N | N | N | N |
| vg1125628490 | C -> G | LOC_Os11g42580.1 | missense_variant ; p.Gln545Glu; MODERATE | nonsynonymous_codon ; Q545E | Average:58.834; most accessible tissue: Zhenshan97 flower, score: 73.141 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125628490 | NA | 8.98E-13 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1125628490 | NA | 4.86E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 9.98E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | 2.24E-07 | NA | mr1133 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 9.89E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 7.47E-09 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | 4.58E-08 | 2.35E-16 | mr1205 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | 2.83E-06 | 1.28E-10 | mr1206 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 4.64E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 8.89E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 7.22E-06 | mr1297 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | 7.55E-06 | 8.15E-07 | mr1367 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 8.74E-07 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 1.53E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 5.74E-12 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 1.58E-06 | mr1820 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 1.64E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 9.65E-06 | mr1858 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 9.69E-06 | mr1859 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 7.52E-07 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 6.39E-06 | mr1898 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 5.26E-08 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 6.71E-06 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 3.82E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125628490 | NA | 1.12E-06 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |