Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125622211:

Variant ID: vg1125622211 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25622211
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

ATATGGGTGGTGCTCAATTCATCGAGGATTCGGATTTGTGTGTGTGTGATTAATTTGGACCACCAGATGTGGTTTCATGTAATAATAAGCGCGACATTAT[C/T]
CCGCAGGTTAATTGATTGTGATGAACCATTGAGTGCTATGTTATATACACATATTATATGCTCTGTTTGTATATATTGAAGGACTGGAACGGAACTGATT

Reverse complement sequence

AATCAGTTCCGTTCCAGTCCTTCAATATATACAAACAGAGCATATAATATGTGTATATAACATAGCACTCAATGGTTCATCACAATCAATTAACCTGCGG[G/A]
ATAATGTCGCGCTTATTATTACATGAAACCACATCTGGTGGTCCAAATTAATCACACACACACAAATCCGAATCCTCGATGAATTGAGCACCACCCATAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.60%	25.90%	1.08%	2.41%	NA
All Indica	2759	56.90%	38.60%	0.47%	3.95%	NA
All Japonica	1512	94.80%	5.20%	0.00%	0.00%	NA
Aus	269	62.80%	21.20%	14.13%	1.86%	NA
Indica I	595	83.70%	15.00%	0.17%	1.18%	NA
Indica II	465	81.30%	18.30%	0.00%	0.43%	NA
Indica III	913	34.20%	55.50%	0.77%	9.53%	NA
Indica Intermediate	786	48.70%	49.00%	0.64%	1.65%	NA
Temperate Japonica	767	97.00%	3.00%	0.00%	0.00%	NA
Tropical Japonica	504	91.50%	8.50%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125622211	C -> T	LOC_Os11g42580.1	upstream_gene_variant ; 4647.0bp to feature; MODIFIER	silent_mutation	Average:59.602; most accessible tissue: Callus, score: 84.376	N	N	N	N
vg1125622211	C -> T	LOC_Os11g42540.1	downstream_gene_variant ; 4827.0bp to feature; MODIFIER	silent_mutation	Average:59.602; most accessible tissue: Callus, score: 84.376	N	N	N	N
vg1125622211	C -> T	LOC_Os11g42550.1	downstream_gene_variant ; 3507.0bp to feature; MODIFIER	silent_mutation	Average:59.602; most accessible tissue: Callus, score: 84.376	N	N	N	N
vg1125622211	C -> T	LOC_Os11g42570.1	downstream_gene_variant ; 490.0bp to feature; MODIFIER	silent_mutation	Average:59.602; most accessible tissue: Callus, score: 84.376	N	N	N	N
vg1125622211	C -> T	LOC_Os11g42540.2	downstream_gene_variant ; 4827.0bp to feature; MODIFIER	silent_mutation	Average:59.602; most accessible tissue: Callus, score: 84.376	N	N	N	N
vg1125622211	C -> T	LOC_Os11g42570-LOC_Os11g42580	intergenic_region ; MODIFIER	silent_mutation	Average:59.602; most accessible tissue: Callus, score: 84.376	N	N	N	N
vg1125622211	C -> DEL	N	N	silent_mutation	Average:59.602; most accessible tissue: Callus, score: 84.376	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125622211	6.38E-07	6.38E-07	mr1068	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	5.35E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	4.85E-06	mr1111	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	2.40E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	6.00E-20	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	7.80E-06	1.59E-15	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	8.19E-06	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	9.13E-06	9.13E-06	mr1526	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	4.62E-06	4.62E-06	mr1609	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	2.89E-06	2.89E-06	mr1644	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	7.22E-08	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	3.41E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	3.86E-09	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	2.61E-06	8.31E-20	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	1.02E-14	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	2.37E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	6.52E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	1.10E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	5.34E-12	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	2.12E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211	NA	1.20E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251