\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125622211:

Variant ID: vg1125622211 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25622211
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGGGTGGTGCTCAATTCATCGAGGATTCGGATTTGTGTGTGTGTGATTAATTTGGACCACCAGATGTGGTTTCATGTAATAATAAGCGCGACATTAT[C/T]
CCGCAGGTTAATTGATTGTGATGAACCATTGAGTGCTATGTTATATACACATATTATATGCTCTGTTTGTATATATTGAAGGACTGGAACGGAACTGATT

Reverse complement sequence

AATCAGTTCCGTTCCAGTCCTTCAATATATACAAACAGAGCATATAATATGTGTATATAACATAGCACTCAATGGTTCATCACAATCAATTAACCTGCGG[G/A]
ATAATGTCGCGCTTATTATTACATGAAACCACATCTGGTGGTCCAAATTAATCACACACACACAAATCCGAATCCTCGATGAATTGAGCACCACCCATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.60% 25.90% 1.08% 2.41% NA
All Indica  2759 56.90% 38.60% 0.47% 3.95% NA
All Japonica  1512 94.80% 5.20% 0.00% 0.00% NA
Aus  269 62.80% 21.20% 14.13% 1.86% NA
Indica I  595 83.70% 15.00% 0.17% 1.18% NA
Indica II  465 81.30% 18.30% 0.00% 0.43% NA
Indica III  913 34.20% 55.50% 0.77% 9.53% NA
Indica Intermediate  786 48.70% 49.00% 0.64% 1.65% NA
Temperate Japonica  767 97.00% 3.00% 0.00% 0.00% NA
Tropical Japonica  504 91.50% 8.50% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125622211 C -> T LOC_Os11g42580.1 upstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:59.602; most accessible tissue: Callus, score: 84.376 N N N N
vg1125622211 C -> T LOC_Os11g42540.1 downstream_gene_variant ; 4827.0bp to feature; MODIFIER silent_mutation Average:59.602; most accessible tissue: Callus, score: 84.376 N N N N
vg1125622211 C -> T LOC_Os11g42550.1 downstream_gene_variant ; 3507.0bp to feature; MODIFIER silent_mutation Average:59.602; most accessible tissue: Callus, score: 84.376 N N N N
vg1125622211 C -> T LOC_Os11g42570.1 downstream_gene_variant ; 490.0bp to feature; MODIFIER silent_mutation Average:59.602; most accessible tissue: Callus, score: 84.376 N N N N
vg1125622211 C -> T LOC_Os11g42540.2 downstream_gene_variant ; 4827.0bp to feature; MODIFIER silent_mutation Average:59.602; most accessible tissue: Callus, score: 84.376 N N N N
vg1125622211 C -> T LOC_Os11g42570-LOC_Os11g42580 intergenic_region ; MODIFIER silent_mutation Average:59.602; most accessible tissue: Callus, score: 84.376 N N N N
vg1125622211 C -> DEL N N silent_mutation Average:59.602; most accessible tissue: Callus, score: 84.376 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125622211 6.38E-07 6.38E-07 mr1068 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 5.35E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 4.85E-06 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 2.40E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 6.00E-20 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 7.80E-06 1.59E-15 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 8.19E-06 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 9.13E-06 9.13E-06 mr1526 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 4.62E-06 4.62E-06 mr1609 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 2.89E-06 2.89E-06 mr1644 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 7.22E-08 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 3.41E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 3.86E-09 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 2.61E-06 8.31E-20 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 1.02E-14 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 2.37E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 6.52E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 1.10E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 5.34E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 2.12E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125622211 NA 1.20E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251