\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125615015:

Variant ID: vg1125615015 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25615015
Reference Allele: CAlternative Allele: A,CA,T,CCA
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.09, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCGCTCCGCCTCCTCGACGCCGCATTCGACGCCGGCGTCAACTTCTTCGACTCCGCCGAGATGTACTACTACGCTCCACTTCTCATCCTGCCCCCCCC[C/A,CA,T,CCA]
CCCTCATCTTTTCCTCTTTTCCAAGAAACACCCCTGGATAAATTATCGGAGGGGCTTTTATGCAAAATGTCTTCCAGGTACCCGGTCCCACAGCGCAGTG

Reverse complement sequence

CACTGCGCTGTGGGACCGGGTACCTGGAAGACATTTTGCATAAAAGCCCCTCCGATAATTTATCCAGGGGTGTTTCTTGGAAAAGAGGAAAAGATGAGGG[G/T,TG,A,TGG]
GGGGGGGGCAGGATGAGAAGTGGAGCGTAGTAGTACATCTCGGCGGAGTCGAAGAAGTTGACGCCGGCGTCGAATGCGGCGTCGAGGAGGCGGAGCGACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 18.90% 0.61% 1.67% CA: 0.76%; CCA: 0.08%; T: 0.02%
All Indica  2759 68.20% 27.90% 0.65% 2.50% CA: 0.62%; T: 0.04%
All Japonica  1512 94.00% 3.40% 0.60% 0.60% CA: 1.06%; CCA: 0.26%
Aus  269 80.70% 18.60% 0.74% 0.00% NA
Indica I  595 61.20% 38.00% 0.84% 0.00% NA
Indica II  465 75.50% 22.20% 0.22% 1.29% CA: 0.86%
Indica III  913 72.20% 21.40% 0.77% 4.71% CA: 0.88%; T: 0.11%
Indica Intermediate  786 64.80% 31.40% 0.64% 2.54% CA: 0.64%
Temperate Japonica  767 96.30% 3.40% 0.00% 0.26% NA
Tropical Japonica  504 89.90% 3.20% 1.79% 1.19% CA: 3.17%; CCA: 0.79%
Japonica Intermediate  241 95.40% 4.10% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 0.00% CA: 1.04%
Intermediate  90 74.40% 22.20% 0.00% 1.11% CA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125615015 C -> A LOC_Os11g42550.1 upstream_gene_variant ; 2692.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> A LOC_Os11g42525.1 downstream_gene_variant ; 2864.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> A LOC_Os11g42530.1 downstream_gene_variant ; 1244.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> A LOC_Os11g42540.1 intron_variant ; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> A LOC_Os11g42540.2 intron_variant ; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> T LOC_Os11g42550.1 upstream_gene_variant ; 2692.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> T LOC_Os11g42525.1 downstream_gene_variant ; 2864.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> T LOC_Os11g42530.1 downstream_gene_variant ; 1244.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> T LOC_Os11g42540.1 intron_variant ; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> T LOC_Os11g42540.2 intron_variant ; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CA LOC_Os11g42550.1 upstream_gene_variant ; 2691.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CA LOC_Os11g42525.1 downstream_gene_variant ; 2865.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CA LOC_Os11g42530.1 downstream_gene_variant ; 1245.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CA LOC_Os11g42540.1 intron_variant ; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CA LOC_Os11g42540.2 intron_variant ; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> DEL N N silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CCA LOC_Os11g42550.1 upstream_gene_variant ; 2691.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CCA LOC_Os11g42525.1 downstream_gene_variant ; 2865.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CCA LOC_Os11g42530.1 downstream_gene_variant ; 1245.0bp to feature; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CCA LOC_Os11g42540.1 intron_variant ; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg1125615015 C -> CCA LOC_Os11g42540.2 intron_variant ; MODIFIER silent_mutation Average:99.207; most accessible tissue: Minghui63 root, score: 99.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125615015 C A 0.01 0.02 0.02 0.01 0.02 0.02
vg1125615015 C CA -0.01 -0.01 0.07 -0.03 0.02 0.04
vg1125615015 C CCA 0.13 0.18 0.26 0.02 0.09 0.12
vg1125615015 C T -0.01 -0.01 0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125615015 NA 7.22E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 2.98E-11 1.66E-16 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 6.50E-08 1.00E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 4.47E-06 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 1.41E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 2.02E-12 6.98E-18 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 4.57E-08 8.25E-11 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 9.49E-07 7.58E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 3.01E-06 1.07E-06 mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 7.80E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 5.37E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 4.24E-19 1.47E-29 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 2.74E-12 1.47E-17 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 1.32E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 1.50E-08 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 7.66E-06 3.33E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 4.55E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 8.45E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 3.71E-08 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 7.94E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 8.30E-09 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125615015 NA 4.85E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251